ID: 1177833959

View in Genome Browser
Species Human (GRCh38)
Location 21:26170244-26170266
Sequence CGACCCCCGCTTCCAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177833945_1177833959 12 Left 1177833945 21:26170209-26170231 CCCTTCCCCCCTGTCTGAATGTC 0: 1
1: 0
2: 3
3: 10
4: 200
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833939_1177833959 29 Left 1177833939 21:26170192-26170214 CCCCACGTGCTCCTTCCCCCTTC 0: 1
1: 0
2: 4
3: 54
4: 789
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833941_1177833959 27 Left 1177833941 21:26170194-26170216 CCACGTGCTCCTTCCCCCTTCCC 0: 1
1: 0
2: 8
3: 131
4: 1170
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833950_1177833959 4 Left 1177833950 21:26170217-26170239 CCCTGTCTGAATGTCTCTCGCCT 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833946_1177833959 11 Left 1177833946 21:26170210-26170232 CCTTCCCCCCTGTCTGAATGTCT 0: 1
1: 0
2: 2
3: 10
4: 319
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833951_1177833959 3 Left 1177833951 21:26170218-26170240 CCTGTCTGAATGTCTCTCGCCTC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833949_1177833959 5 Left 1177833949 21:26170216-26170238 CCCCTGTCTGAATGTCTCTCGCC 0: 1
1: 1
2: 1
3: 17
4: 190
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833948_1177833959 6 Left 1177833948 21:26170215-26170237 CCCCCTGTCTGAATGTCTCTCGC 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833940_1177833959 28 Left 1177833940 21:26170193-26170215 CCCACGTGCTCCTTCCCCCTTCC 0: 1
1: 0
2: 0
3: 61
4: 579
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833942_1177833959 18 Left 1177833942 21:26170203-26170225 CCTTCCCCCTTCCCCCCTGTCTG 0: 1
1: 0
2: 8
3: 168
4: 1684
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833943_1177833959 14 Left 1177833943 21:26170207-26170229 CCCCCTTCCCCCCTGTCTGAATG 0: 1
1: 0
2: 2
3: 21
4: 265
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833944_1177833959 13 Left 1177833944 21:26170208-26170230 CCCCTTCCCCCCTGTCTGAATGT 0: 1
1: 0
2: 2
3: 27
4: 253
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1177833947_1177833959 7 Left 1177833947 21:26170214-26170236 CCCCCCTGTCTGAATGTCTCTCG 0: 1
1: 0
2: 1
3: 12
4: 186
Right 1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177833959 Original CRISPR CGACCCCCGCTTCCAAGGCA GGG Intronic
901771791 1:11534313-11534335 CCACCCGCCCTTCCCAGGCATGG - Intronic
904046478 1:27612256-27612278 CCACCCCCGCTCCCAAAGGAAGG + Exonic
905248503 1:36630944-36630966 GGAGCCCCTCGTCCAAGGCATGG + Intergenic
906356039 1:45106456-45106478 CGCCCCCCACTTCCCAGACAGGG - Intronic
918701896 1:187616740-187616762 CGCTCCCCGCTTCCCAGACAGGG - Intergenic
924743645 1:246812941-246812963 CTATCCCCGCTTCCAGGCCACGG + Intergenic
1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG + Intergenic
1075632606 10:124010281-124010303 AGAGCCCCGCATCCAATGCACGG - Exonic
1078101781 11:8334375-8334397 TGCCCCCGGCTTCCAAGGCTGGG + Intergenic
1089749653 11:120641968-120641990 CCACCCCCGCTTCCCAAGCCTGG + Intronic
1089915923 11:122156286-122156308 CGAACCCCGCGTCCAAAACATGG - Intergenic
1098677832 12:73313779-73313801 ACACCCCCACTTCAAAGGCATGG - Intergenic
1103776828 12:123372182-123372204 CGCCCCTCGCTTCCCAGACAGGG - Intergenic
1105267790 13:18837193-18837215 CGCTCCCCACTTCCAAGACAGGG + Intergenic
1105281066 13:18962860-18962882 CCACCCCAGCTTCCATGGAAGGG + Intergenic
1116502092 14:45635051-45635073 CGCTCCCCGCCTCCCAGGCAGGG - Intergenic
1125031979 15:35082666-35082688 CGACCCCCACTTCCCAGACGGGG - Intergenic
1125655154 15:41350471-41350493 CGACCCCTGGTTCCAGAGCAAGG - Intronic
1127804130 15:62503011-62503033 CCACCCCCTCTTCCAAGGCCAGG + Intronic
1131981555 15:97999555-97999577 AGACCCCCACTTGCAAGCCAAGG + Intergenic
1134232407 16:12439029-12439051 CAGCCCGGGCTTCCAAGGCAGGG + Intronic
1135023080 16:18978806-18978828 CCACCACCCCTGCCAAGGCAAGG - Intergenic
1139316169 16:66070883-66070905 CGACCCCCTCTTCCTAAGCCTGG - Intergenic
1141673790 16:85506922-85506944 AGCCCCCTCCTTCCAAGGCATGG + Intergenic
1141695157 16:85615594-85615616 CGACCTCCCTTCCCAAGGCAGGG - Intronic
1141770266 16:86085518-86085540 AGACCCCCATTCCCAAGGCAGGG - Intergenic
1141902198 16:86998317-86998339 CGACTCCAGCTTCCAAGGCGAGG - Intergenic
1143498194 17:7324265-7324287 CACCCCCTTCTTCCAAGGCAGGG - Exonic
1147442314 17:40454675-40454697 GGACCCCAGCTTCCAAGGGCAGG - Intronic
1150287144 17:63960887-63960909 TCACCCCTGCTTCCAGGGCATGG + Intronic
1154420422 18:14223586-14223608 CGCTCCCCACTTCCTAGGCAGGG - Intergenic
1160662071 19:305925-305947 CCTCCCCCGGTACCAAGGCAGGG - Exonic
1162393635 19:10404077-10404099 AAACCCCAGCTCCCAAGGCAGGG - Intronic
1166361783 19:42255506-42255528 TGACCCCCGCTTCCTCGGAAGGG - Intergenic
1167332820 19:48866972-48866994 GTACCACCGCTTCCAAGGAAGGG - Intronic
1167643909 19:50695640-50695662 GGAGCCCCGCTTCCCCGGCAGGG + Intronic
1167836424 19:52075548-52075570 GGACCCCAGCTTCAAAGGAAGGG + Intronic
1167985157 19:53308517-53308539 AGACCCGCGCTTCCAGAGCAGGG - Intergenic
1168687703 19:58358437-58358459 CCAGCCCCGCTGCCAAGGCAGGG + Intronic
926892603 2:17650771-17650793 CGAGGCCAGCTTCCCAGGCAGGG - Intronic
936713811 2:115162091-115162113 CGCCTCCCGCTTCCCAGGCTGGG + Intronic
937026260 2:118700075-118700097 CAGCCCCCGCTTCAAGGGCAAGG + Intergenic
937337276 2:121069756-121069778 CCACCCCCTCCACCAAGGCATGG - Intergenic
941225026 2:162838363-162838385 CGTCCACCGCTTCCAAGGTGGGG - Intronic
944437335 2:199704379-199704401 CGACCCCCAACTCCAAGGCTTGG - Intergenic
949075548 2:242055386-242055408 CCAGCACCGCTTCCAAGGCCGGG - Intergenic
1172094906 20:32455856-32455878 CTACCACCTCTACCAAGGCAGGG + Intronic
1177833959 21:26170244-26170266 CGACCCCCGCTTCCAAGGCAGGG + Intronic
1184089011 22:42282778-42282800 CGGCCCCCTCCTCCCAGGCATGG - Intronic
949548899 3:5096229-5096251 CGCCCCCCGCTGCCTAGGGAAGG - Intergenic
953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG + Intronic
960948480 3:122983034-122983056 CGACCCCAGCTGGCCAGGCAGGG + Intronic
961627786 3:128275637-128275659 CCAACCCTGCTTCCCAGGCAAGG + Intronic
981941600 4:150287295-150287317 CTAACCCGGCTTCCAAAGCAAGG + Intronic
985155787 4:186986208-186986230 CTACCCGAGCTGCCAAGGCAGGG - Intergenic
986718183 5:10538971-10538993 CGACCCACACCTCCATGGCATGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1018730882 6:166649646-166649668 CAACCCCCACTCCCAGGGCAAGG + Intronic
1019291688 7:253646-253668 GGACCCCCGCTTCCCGGGCGAGG + Intronic
1019737334 7:2657042-2657064 GGACCCCCACTTCAAAGGTAAGG - Intronic
1022190046 7:28008495-28008517 CTACCCCAGCTTCCAAGACAAGG + Intronic
1034276283 7:149825211-149825233 GGGCCCCCGCTTCCACTGCACGG - Intergenic
1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG + Intronic
1048499266 8:134960892-134960914 CCAGCCTCCCTTCCAAGGCAAGG - Intergenic
1049470703 8:142773986-142774008 TGACCCCTGCTTCCCAGGCCTGG + Intronic
1049498424 8:142947584-142947606 TGATCCCCGCTTCCCAGACAGGG + Intergenic
1051160628 9:14203660-14203682 CCAACCCTGCTACCAAGGCAGGG + Intronic
1055981513 9:82007230-82007252 CTACCCCTGCTCCCAAGCCAAGG - Intergenic
1057192744 9:93096446-93096468 CGGCCCCCGCTGCCCAGGCGCGG - Intronic
1061737170 9:132669768-132669790 CGAAACCCGACTCCAAGGCACGG + Intronic
1192504999 X:71676178-71676200 CGCCCCTCACTTCCCAGGCAGGG - Intergenic
1192885887 X:75335422-75335444 CGCCCCTCACTTCCCAGGCAGGG + Intergenic