ID: 1177834325

View in Genome Browser
Species Human (GRCh38)
Location 21:26171981-26172003
Sequence CGGGGTACAGACTTCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177834320_1177834325 -1 Left 1177834320 21:26171959-26171981 CCGGGAAGGATGGCTCAGCCAGC No data
Right 1177834325 21:26171981-26172003 CGGGGTACAGACTTCCTTCCTGG No data
1177834318_1177834325 6 Left 1177834318 21:26171952-26171974 CCTAGGCCCGGGAAGGATGGCTC No data
Right 1177834325 21:26171981-26172003 CGGGGTACAGACTTCCTTCCTGG No data
1177834319_1177834325 0 Left 1177834319 21:26171958-26171980 CCCGGGAAGGATGGCTCAGCCAG No data
Right 1177834325 21:26171981-26172003 CGGGGTACAGACTTCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177834325 Original CRISPR CGGGGTACAGACTTCCTTCC TGG Intergenic
No off target data available for this crispr