ID: 1177836048

View in Genome Browser
Species Human (GRCh38)
Location 21:26187304-26187326
Sequence TCCCAAAGTTCAGGGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177836044_1177836048 -9 Left 1177836044 21:26187290-26187312 CCTGGGCTCAAGCCTCCCAAAGT 0: 8
1: 21
2: 48
3: 101
4: 548
Right 1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG No data
1177836040_1177836048 10 Left 1177836040 21:26187271-26187293 CCCAGGCTGATCTCAAACTCCTG 0: 1549
1: 23247
2: 42718
3: 58143
4: 48470
Right 1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG No data
1177836041_1177836048 9 Left 1177836041 21:26187272-26187294 CCAGGCTGATCTCAAACTCCTGG 0: 1486
1: 24770
2: 91797
3: 159628
4: 186051
Right 1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177836048 Original CRISPR TCCCAAAGTTCAGGGATTGC AGG Intergenic
No off target data available for this crispr