ID: 1177842131

View in Genome Browser
Species Human (GRCh38)
Location 21:26246394-26246416
Sequence ATTCCCTTTTAGCATGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177842131_1177842136 8 Left 1177842131 21:26246394-26246416 CCTTTTACATGCTAAAAGGGAAT No data
Right 1177842136 21:26246425-26246447 AAGGGAAATCAGGCCAGGTGCGG No data
1177842131_1177842133 -10 Left 1177842131 21:26246394-26246416 CCTTTTACATGCTAAAAGGGAAT No data
Right 1177842133 21:26246407-26246429 AAAAGGGAATGCTAAAGAAAGGG No data
1177842131_1177842137 11 Left 1177842131 21:26246394-26246416 CCTTTTACATGCTAAAAGGGAAT No data
Right 1177842137 21:26246428-26246450 GGAAATCAGGCCAGGTGCGGTGG No data
1177842131_1177842135 3 Left 1177842131 21:26246394-26246416 CCTTTTACATGCTAAAAGGGAAT No data
Right 1177842135 21:26246420-26246442 AAAGAAAGGGAAATCAGGCCAGG No data
1177842131_1177842134 -2 Left 1177842131 21:26246394-26246416 CCTTTTACATGCTAAAAGGGAAT No data
Right 1177842134 21:26246415-26246437 ATGCTAAAGAAAGGGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177842131 Original CRISPR ATTCCCTTTTAGCATGTAAA AGG (reversed) Intergenic