ID: 1177850310

View in Genome Browser
Species Human (GRCh38)
Location 21:26338883-26338905
Sequence CATATATGACTACTATTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177850310_1177850313 8 Left 1177850310 21:26338883-26338905 CCACTCAATAGTAGTCATATATG No data
Right 1177850313 21:26338914-26338936 ACAGCTAGTATCATACTGAATGG 0: 226
1: 1004
2: 11138
3: 6290
4: 6142
1177850310_1177850314 9 Left 1177850310 21:26338883-26338905 CCACTCAATAGTAGTCATATATG No data
Right 1177850314 21:26338915-26338937 CAGCTAGTATCATACTGAATGGG 0: 204
1: 971
2: 10405
3: 5646
4: 4177
1177850310_1177850315 10 Left 1177850310 21:26338883-26338905 CCACTCAATAGTAGTCATATATG No data
Right 1177850315 21:26338916-26338938 AGCTAGTATCATACTGAATGGGG 0: 231
1: 443
2: 692
3: 933
4: 1601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177850310 Original CRISPR CATATATGACTACTATTGAG TGG (reversed) Intergenic
No off target data available for this crispr