ID: 1177852024

View in Genome Browser
Species Human (GRCh38)
Location 21:26359901-26359923
Sequence ATGAAGAAAAGGTGTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177852019_1177852024 -2 Left 1177852019 21:26359880-26359902 CCATGATTGATAATAACCCATAT No data
Right 1177852024 21:26359901-26359923 ATGAAGAAAAGGTGTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177852024 Original CRISPR ATGAAGAAAAGGTGTGGTCA AGG Intergenic
No off target data available for this crispr