ID: 1177856491

View in Genome Browser
Species Human (GRCh38)
Location 21:26405995-26406017
Sequence GCTTTAGAGTCTGTTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177856486_1177856491 19 Left 1177856486 21:26405953-26405975 CCCAAGGGCTCTTCTCAGCAGAG No data
Right 1177856491 21:26405995-26406017 GCTTTAGAGTCTGTTCCCTGGGG No data
1177856487_1177856491 18 Left 1177856487 21:26405954-26405976 CCAAGGGCTCTTCTCAGCAGAGT No data
Right 1177856491 21:26405995-26406017 GCTTTAGAGTCTGTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177856491 Original CRISPR GCTTTAGAGTCTGTTCCCTG GGG Intergenic
No off target data available for this crispr