ID: 1177862236

View in Genome Browser
Species Human (GRCh38)
Location 21:26468247-26468269
Sequence GATCCACCTAAGCACATTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177862236_1177862238 -2 Left 1177862236 21:26468247-26468269 CCCTGAATGTGCTTAGGTGGATC 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1177862238 21:26468268-26468290 TCAGCAGATCTCTTAAAATGTGG 0: 1
1: 1
2: 0
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177862236 Original CRISPR GATCCACCTAAGCACATTCA GGG (reversed) Exonic
901511140 1:9718592-9718614 GACCCACCTGAGGACATTCAAGG + Intronic
908055742 1:60284922-60284944 AAGCCACCTACGCACATTCTTGG - Intergenic
910317088 1:85898370-85898392 GATCCTCTGAGGCACATTCAGGG + Intronic
921363080 1:214348226-214348248 TAACCACCATAGCACATTCACGG - Intergenic
1067233565 10:44428060-44428082 GATTCAGCTAGACACATTCAGGG - Intergenic
1073295020 10:102433675-102433697 GATCCACCTGAGCCCTGTCATGG + Intergenic
1073745269 10:106461257-106461279 GATTCAAATAAGCACAGTCAGGG - Intergenic
1075726602 10:124613731-124613753 ACTCCACCTAACCAGATTCAGGG + Exonic
1078998033 11:16724090-16724112 GATACACACAAGCACATTGAGGG + Intronic
1080762169 11:35262212-35262234 GAGCCAAATAGGCACATTCAAGG - Intronic
1080948715 11:37004182-37004204 GTTCAACCTAAGCACAGGCATGG + Intergenic
1081352894 11:42076332-42076354 GAAACAGCTAAGTACATTCAAGG - Intergenic
1084379346 11:68801193-68801215 GTTCCACTTCAGCTCATTCAGGG - Intronic
1084587165 11:70068971-70068993 GATGCACCTAAGAAAATACATGG - Intergenic
1085393715 11:76195509-76195531 GATCCTCCCTAGCACCTTCAGGG + Intronic
1096704755 12:53412609-53412631 GAACCACCCAAGAACATACAAGG - Intronic
1117636326 14:57747863-57747885 AATCTAACTAAGAACATTCAGGG - Intronic
1119198463 14:72734853-72734875 GATGTACCAAAGCTCATTCAGGG - Intronic
1119518717 14:75269560-75269582 AAACCAACTAAGCACATTCTGGG + Intergenic
1124121304 15:26891609-26891631 GATTCACCGAAGCACGTTTAGGG + Intronic
1124194530 15:27609914-27609936 GACTCACCTCAGCACATTCTGGG + Intergenic
1127564602 15:60174766-60174788 GATCTACCTAAGCTAATTCTAGG + Intergenic
1138597151 16:58035141-58035163 GATCTCCCTAAGCACCTTCAGGG + Intronic
1203143297 16_KI270728v1_random:1783227-1783249 CAGCCACCTAAGCACAATCAAGG - Intergenic
1148437031 17:47693249-47693271 GCCCCACCTAAGCACTCTCATGG - Intergenic
1148997558 17:51724333-51724355 GACCCTCCTAAGCACATATATGG - Intronic
1150215689 17:63467754-63467776 GACCCTCATAAGCACCTTCAAGG + Intergenic
1151650282 17:75463965-75463987 GATCCACCTAACCGCATTTTTGG + Intronic
1153345866 18:4025146-4025168 ACTCCACCTATGCACACTCAAGG - Intronic
1158981409 18:62765611-62765633 GATCTACTTAAGCAGATACATGG - Intronic
1160221835 18:76983796-76983818 GATCCACATGAGCACAGACATGG - Intronic
1165744170 19:38220891-38220913 GATATTCCTAAACACATTCAAGG + Intronic
929576314 2:43055054-43055076 CACCCACCCATGCACATTCAGGG + Intergenic
933741511 2:85538210-85538232 GATCTGCTTAAGCACATTCAAGG + Intergenic
936434793 2:112495162-112495184 AATCCATGTAAGCACATTCTAGG - Intronic
938758139 2:134399461-134399483 AATCCACCTAAGCTCATTTGAGG - Intronic
938998583 2:136707248-136707270 GATCCCCCTAAGCCCATTCATGG - Intergenic
943316510 2:186395716-186395738 AATCCACAGAAGCATATTCATGG - Intergenic
944338578 2:198567547-198567569 GATGCCCTTAAACACATTCATGG + Intronic
947604772 2:231478870-231478892 GATTCACCTAGCCACACTCACGG + Intronic
1174543643 20:51308626-51308648 GATACACCAAAGCTCATTCCAGG + Intergenic
1175663026 20:60833874-60833896 GGTCCTCATTAGCACATTCAGGG - Intergenic
1177862236 21:26468247-26468269 GATCCACCTAAGCACATTCAGGG - Exonic
951176291 3:19604629-19604651 GATCTAGCTAAGCTCATTGATGG - Intergenic
953348653 3:42197832-42197854 CATCCACCTCAGCAGCTTCATGG - Intronic
956622578 3:71236060-71236082 GAATCACCTAGGAACATTCAAGG + Intronic
957664751 3:83212721-83212743 TAACCACCCAAGCACATTAAGGG + Intergenic
957852204 3:85822748-85822770 GATCCACATATGAAAATTCATGG - Intronic
959397810 3:105863366-105863388 GTTCCACCTTAGCAGAATCATGG - Intronic
962655391 3:137539072-137539094 GATACAAATAAGCACAATCAAGG - Intergenic
967478603 3:189948997-189949019 GATCAACCTCAGAACCTTCAAGG - Intergenic
973713084 4:53648799-53648821 CATCCCCCTGAACACATTCATGG + Intronic
978397375 4:108295802-108295824 GATCCACCAAAGCAAATAAAAGG - Intergenic
978962197 4:114694128-114694150 GATACTACAAAGCACATTCAGGG + Intergenic
979551188 4:121992741-121992763 GACCCAAAAAAGCACATTCAAGG - Intergenic
982009360 4:151091960-151091982 GATCGAAATCAGCACATTCAAGG + Intergenic
984121341 4:175748857-175748879 GATCTAGCTAAGAACATTGATGG - Intronic
986095429 5:4549560-4549582 GCTCAACCTATTCACATTCAGGG - Intergenic
988413885 5:30920912-30920934 GTGCTACCTAAGTACATTCAAGG + Intergenic
994677998 5:102849172-102849194 TATCCACCCAAACACAATCATGG + Intronic
995214345 5:109577827-109577849 GATCCAGCTAAGATCATTGACGG - Intergenic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
997555330 5:134792769-134792791 CATGTACCTAAGCACATACACGG - Intronic
998932894 5:147200880-147200902 GATCCACCTGAGGACAGACAAGG - Intergenic
999905463 5:156136510-156136532 GATCCACTTAAGTGCATCCATGG + Intronic
1002161683 5:177317757-177317779 GAGCCACCTAAGGAGTTTCACGG - Intergenic
1003619887 6:7690556-7690578 AACCCACCTAAGTACATTCTGGG - Intergenic
1005445092 6:25914791-25914813 CATTCACCTAAAGACATTCAGGG + Intronic
1006402606 6:33826544-33826566 GATACACCCCAGGACATTCATGG + Intergenic
1006730156 6:36230552-36230574 GATCCACCTGAGCAGAGTCCGGG + Exonic
1013742837 6:113308387-113308409 GATCAAGCTATGCTCATTCATGG - Intergenic
1021015619 7:15527591-15527613 GATCTAGCTAAGACCATTCAAGG + Intronic
1021886578 7:25145342-25145364 GATCTACTGAAACACATTCAAGG + Intronic
1022206494 7:28169270-28169292 GCTCCACTTCAGCACTTTCAGGG - Intronic
1026354176 7:69542899-69542921 TATGCACGGAAGCACATTCATGG - Intergenic
1030385318 7:108861213-108861235 GCACCACCTAAGAACATTCTGGG - Intergenic
1036166599 8:6440320-6440342 GATTCACGTAGGCACATGCAGGG - Intronic
1037060958 8:14508592-14508614 GACCCACCAAGGCACATTTATGG - Intronic
1039337240 8:36605051-36605073 GATGCAATTAAGAACATTCATGG - Intergenic
1046941423 8:119935050-119935072 AATTCATCTAAGTACATTCAGGG + Intronic
1047641686 8:126827716-126827738 GCTCCCCCTAAGGATATTCAGGG - Intergenic
1051821620 9:21177175-21177197 GATCCACCTAAGGTCACTGATGG + Intergenic
1052285564 9:26781101-26781123 GTTCCACCTCAGCACACCCAGGG - Intergenic
1056489351 9:87089601-87089623 CATCCACCTTAACTCATTCAGGG - Intergenic
1186350422 X:8733315-8733337 CACCCAGCTAAGCACAGTCAGGG + Intergenic
1195939118 X:110152827-110152849 GCTCCCCCTAAGCCCATTCCTGG + Intronic
1199860201 X:151794592-151794614 GAACTACCTAAGCATATTCTAGG - Intergenic