ID: 1177863113

View in Genome Browser
Species Human (GRCh38)
Location 21:26478587-26478609
Sequence TGCGGGAAATGGGGAACCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177863104_1177863113 25 Left 1177863104 21:26478539-26478561 CCTTTTACTTTGGATAAAATGAA 0: 1
1: 0
2: 3
3: 61
4: 565
Right 1177863113 21:26478587-26478609 TGCGGGAAATGGGGAACCGCTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1177863105_1177863113 -1 Left 1177863105 21:26478565-26478587 CCACACGCTTTAATGCCTCCTCT 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1177863113 21:26478587-26478609 TGCGGGAAATGGGGAACCGCTGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177863113 Original CRISPR TGCGGGAAATGGGGAACCGC TGG Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901608144 1:10475231-10475253 GGCGGGAAGTGGGGACCCGGGGG - Intronic
901678126 1:10898567-10898589 TGCGGGAAGTGGGGGCCGGCAGG + Intergenic
903381266 1:22898563-22898585 TGAGTGAAATGGGGAGCTGCTGG + Intronic
904199897 1:28812703-28812725 TGCAGGAAATGCGGAGGCGCGGG - Intronic
907703659 1:56814293-56814315 TGTGGGCAATGGGGAACAACTGG + Intronic
911137416 1:94456067-94456089 TGGGGGAAATGGGGAAAAGTTGG - Intronic
923806241 1:237261314-237261336 TGGGGGAAATGGGCAGCCACTGG - Intronic
1063377624 10:5563546-5563568 TGCCGGAAATGGGGAGCTGCCGG + Intergenic
1063629629 10:7721711-7721733 TGCGGTAGATGGGGAACTGGTGG + Exonic
1064998121 10:21314219-21314241 TGCTGGAGATGGTGAACAGCTGG - Intergenic
1069266790 10:66468468-66468490 TGGGGGAAATGGGAAAATGCTGG + Intronic
1070358064 10:75659641-75659663 TGGGGGAAATGGGCAACTGTTGG + Intronic
1072912114 10:99511726-99511748 TGGGGGAAATGAGGAGACGCTGG + Intergenic
1075160194 10:120017169-120017191 TGGGGGAAATGGGGAGATGCTGG + Intergenic
1076006151 10:126949262-126949284 TGTGGGGAATGGGGAGCCGCAGG + Intronic
1080387920 11:31820390-31820412 TGCGGGAAGAAGGGCACCGCGGG + Intronic
1086613878 11:88790896-88790918 TGCAGGCAATGGGGAGCCTCTGG + Intronic
1088538325 11:110885667-110885689 TGCAGGAAATGGGGAACACCTGG + Intergenic
1091140433 11:133229746-133229768 TGAGGGTAAGGGGGAACTGCTGG + Intronic
1091455831 12:607153-607175 TGCTGGAAATGCAGAACCTCAGG + Intronic
1091626791 12:2127176-2127198 TGTGGGAATGGGGGAACCTCAGG - Intronic
1092045588 12:5430259-5430281 TGCGGGAAGTGGGGGAGGGCAGG + Intergenic
1092518397 12:9240190-9240212 TGAGGAAAATGGGGAGCCGGAGG - Intergenic
1092796085 12:12111282-12111304 TGAGGAAAATGGGGAGCCGGAGG + Intronic
1103452973 12:121042504-121042526 TGAATGAAATGGGGAACCACTGG + Intergenic
1104739922 12:131164768-131164790 TGGGGGAGCTGGGGACCCGCGGG - Intergenic
1104792557 12:131493197-131493219 TGGGGGAGCTGGGGACCCGCGGG + Intergenic
1113647607 13:112010194-112010216 TGAGGGAGATGGGGAGACGCTGG + Intergenic
1114243703 14:20893083-20893105 TCCTGGAGATGGGGAGCCGCTGG + Intergenic
1114646815 14:24260567-24260589 TGGGGGAAGTGTGGACCCGCAGG + Exonic
1117102925 14:52369032-52369054 TGAAGGAAATGGGGAACCAAAGG + Intergenic
1117583950 14:57180961-57180983 TGGGGGAAATGGGGAGCTGATGG + Intergenic
1117892436 14:60440666-60440688 TGAGTGAAATGGGAAACCTCTGG - Intronic
1118442278 14:65822657-65822679 TGAGTGAAATGGGGAACCATTGG - Intergenic
1118617565 14:67585210-67585232 TTAGGGGAATGGGGAACAGCTGG - Intronic
1119874479 14:78045755-78045777 TGGGGGAAATGGGGAGATGCTGG + Intergenic
1120897871 14:89550407-89550429 TCCAGGAAATGGGGAAGGGCTGG - Intronic
1124028775 15:25990282-25990304 TGGGGGAAATGGGGGACAACTGG - Intergenic
1124913945 15:33950210-33950232 TGAGGGAAATGGGGAGATGCTGG + Intronic
1126069478 15:44853175-44853197 TGCGTGAAATGTTGAACTGCAGG + Intergenic
1128414675 15:67434220-67434242 TGGGGGAAATGGGGAGATGCTGG - Intronic
1131116911 15:89801548-89801570 TGCGGGACATCATGAACCGCTGG - Exonic
1132995866 16:2822140-2822162 TGCAGGAAATGGGGAAACCGAGG + Intronic
1133668553 16:7995074-7995096 TATGGGAAATGGGGAACGTCTGG - Intergenic
1134079391 16:11314599-11314621 TGCTGGAAATGCAGAACTGCAGG - Intronic
1136003604 16:27313961-27313983 AGCGGGAAGTGGGGGACCCCTGG - Exonic
1136556276 16:31009691-31009713 TGGGGGAACTGGGGCACCCCGGG - Intronic
1137733766 16:50709426-50709448 TTCAGGAAATGGGGAAGTGCTGG - Intronic
1138081468 16:54094913-54094935 TAAGTGAGATGGGGAACCGCCGG - Intronic
1141255908 16:82402108-82402130 TGAGGGAGATGGGAAACCACTGG + Intergenic
1142794687 17:2298860-2298882 GGAGGGAAATGGGGATCAGCCGG - Intronic
1146009128 17:29180072-29180094 GGCGGGGAAGGGGGAACCACCGG - Intronic
1148093131 17:45034567-45034589 TGCTGGTAATGGGGTACAGCTGG + Intronic
1151469599 17:74309771-74309793 TGGGGGCATTGGGGAACCACAGG + Intronic
1152510171 17:80781395-80781417 TCCGGGAAGAAGGGAACCGCAGG - Intronic
1158550426 18:58431098-58431120 GGCCTGAAATGGGGAACCGGAGG - Intergenic
1162762188 19:12895341-12895363 TGCTTGAACTGGGGAACCGCAGG - Intronic
1163631005 19:18417837-18417859 GGCGGGAAGTCGGGAGCCGCCGG - Intergenic
1163662843 19:18588971-18588993 TGCGGGACAGGGGGCACGGCTGG - Intronic
1163730631 19:18947247-18947269 TGCGGGAATTGGGGGTCGGCTGG + Intergenic
1165426589 19:35749218-35749240 TGCTGGAAATGGGGAAACTGAGG - Intronic
1165654911 19:37524720-37524742 TGTGGGAAATATGGAACGGCAGG + Intronic
1166624350 19:44336514-44336536 TGTGTGAAATGGGGAGCCACAGG + Intronic
1166817855 19:45557577-45557599 TGTGGGAGAAGGGGAACAGCTGG - Intronic
929292503 2:40209494-40209516 TGAGGGAAATAGGGAGCCACTGG + Intronic
930093729 2:47551049-47551071 TGAGTGAAATGGGGAGCCACGGG - Intronic
942672217 2:178388376-178388398 TGCAGGCAATGGGCCACCGCAGG - Intronic
942919757 2:181358159-181358181 TGGGGGAAATGGGGAAATGTTGG - Intergenic
945243525 2:207698076-207698098 TGGGGGAAATGGGAAGCCACTGG - Intergenic
945941169 2:215951909-215951931 TGGGGGAAATGGGGAAATGCTGG - Intronic
947397252 2:229698301-229698323 TGCAGGAAATGGAGACCAGCAGG - Intronic
947801018 2:232928458-232928480 TGCGGGCACTGGGGAGCCGAGGG - Intronic
948862019 2:240757235-240757257 TGCGGGCACAGAGGAACCGCTGG - Intronic
1169071797 20:2737282-2737304 TGGGGGAAGAGGGGGACCGCAGG + Intronic
1170427044 20:16245489-16245511 TGTGGGAAATGGGGAGCTGTTGG - Intergenic
1172596644 20:36154869-36154891 TGCCCGACATGGGGAACCCCGGG + Exonic
1175367499 20:58466317-58466339 TGCTGGAAATGCAGAACCCCGGG + Intronic
1175631527 20:60542153-60542175 TGGAGGAAAAGGGGAACAGCTGG - Intergenic
1175886835 20:62296965-62296987 TGTGGGAAGTGGGGGACAGCTGG + Intergenic
1176184459 20:63770806-63770828 TGCAGGAAATGGGGACACGGCGG - Intronic
1177863113 21:26478587-26478609 TGCGGGAAATGGGGAACCGCTGG + Intronic
1179605247 21:42511916-42511938 TGGGAGAAATGGGGAGTCGCTGG + Intronic
1182211221 22:28679309-28679331 TGGGGGAAAAGGGGAGGCGCTGG + Intronic
1183901556 22:41009716-41009738 TGTGGGCAATGGGGAGCTGCTGG + Intergenic
1185427154 22:50778600-50778622 TGAAAGAAATGGGGAACCACTGG - Intronic
950055308 3:10019383-10019405 TAGGGGAAATGGGGAAGCGGGGG + Intergenic
953774313 3:45802454-45802476 TGTGGGAAATGCAGAATCGCAGG - Intergenic
956472751 3:69585152-69585174 TGAGGGAAATGGGGAAATACTGG + Intergenic
961809779 3:129515098-129515120 TGTGGGAAAGGGGGAACCCAAGG - Intronic
963639123 3:147836908-147836930 TGTGGGAAATGTGGATCCCCTGG + Intergenic
965881997 3:173397637-173397659 TGGGGCAAGTGGGGAGCCGCGGG - Intronic
969956190 4:10893400-10893422 TGGGGGAAATGAGGAACCGTCGG - Intergenic
972099017 4:35388707-35388729 TTCTGGAAGTGGGGAACAGCAGG - Intergenic
973641440 4:52906562-52906584 TGCTGAAAATTGGGAACAGCAGG + Intronic
977907642 4:102496989-102497011 AGTGGGAAATGGGGAAACGAGGG - Intergenic
982795329 4:159637428-159637450 TGAGGAAAATGGGGACCAGCAGG - Intergenic
985115141 4:186583222-186583244 TGGGGGAAATGGGGAAATGTTGG - Intergenic
989486801 5:41999961-41999983 TGAGGGAAATGGGGAAATGTTGG - Intergenic
995686212 5:114775349-114775371 TGGGGGAAATGGGGAAATGTTGG - Intergenic
997459403 5:134041904-134041926 TGAGGGAAATGGGTCACCTCAGG - Intergenic
997660956 5:135589313-135589335 TGAGGGAAATGGGGAAGCCAAGG - Intergenic
997741715 5:136260658-136260680 TGAGGGAAATGGGAAGCCACTGG + Intronic
1000266885 5:159646655-159646677 TATGGGAAATGGGAAAACGCTGG + Intergenic
1003611290 6:7617139-7617161 TGTGTGAGATGGGGACCCGCTGG - Intergenic
1005826114 6:29632726-29632748 TGGGGGAGAGGAGGAACCGCGGG - Intronic
1007266449 6:40599873-40599895 TGAGGGGAATGGGGAACACCTGG + Intergenic
1008269009 6:49467408-49467430 TGCAGGGAATGGGGAAGGGCAGG + Intronic
1019430555 7:997089-997111 TGCGGGTCATGGGGAGCCCCTGG - Exonic
1023080138 7:36519150-36519172 TGAGGGACATGGGGAGCCACTGG - Intronic
1026469834 7:70685798-70685820 TGTGGGAAACGGGGAACTGCTGG - Intronic
1027477936 7:78656536-78656558 TGGGGGAAATGGGGAGATGCTGG + Intronic
1030255654 7:107506715-107506737 TGCGGGAAAACAGGAACCACAGG + Intronic
1031338125 7:120563369-120563391 TGCGGGCAATGGGGAAATGAAGG - Intronic
1031531997 7:122886656-122886678 GGCGGGCTCTGGGGAACCGCTGG - Intronic
1034363241 7:150521243-150521265 TGGGGGAAATGGGGAAATGTTGG - Intergenic
1035579589 8:731585-731607 AGCGGGGACTGGGGATCCGCAGG - Intronic
1036726828 8:11228118-11228140 TGGGGGAAATGGGGAACACAGGG + Intergenic
1038468895 8:27793877-27793899 TGGGAGAAATGGGGAAACGTTGG - Intronic
1039360018 8:36866026-36866048 TGGGGGAAATGGGGAGCTGTTGG + Intronic
1039484590 8:37900579-37900601 AGGGAGAAATGGGGAACTGCGGG - Intergenic
1039793429 8:40893084-40893106 TGCTGGAGATGGAGAACAGCTGG + Intronic
1050344265 9:4670778-4670800 TGCTGTAGATGGGGAACCGCTGG - Intergenic
1054867791 9:70020418-70020440 TCAGGGAAATGGGGAAAAGCTGG + Intergenic
1056739237 9:89238651-89238673 TGGGGGAGGTGGGGAACAGCAGG + Intergenic
1056747635 9:89318351-89318373 TGCGGAAAATGGGGACCCCCAGG - Intergenic
1056768652 9:89460934-89460956 TGCGGGGTGTGGGGAACAGCAGG - Intronic
1057334395 9:94144350-94144372 TGCGGGAAATGGGAAGCTGTGGG - Intergenic
1057824655 9:98362954-98362976 TGTGGGTGATGGGGAATCGCAGG - Intronic
1061492601 9:130954366-130954388 TGTTGAAAATGGGGAACCCCTGG - Intergenic
1062554110 9:137106343-137106365 TGCGGGAACGGGGGAGCCGCGGG - Intronic
1185764289 X:2712231-2712253 TGGGGGAAATGGGGAAATGATGG + Intronic
1187440604 X:19315064-19315086 TGAGGGAAATGGGGAAATGTTGG - Intergenic
1187901439 X:24030020-24030042 TGTGAGAAATTGGGAACCACTGG + Intergenic
1189301883 X:39958149-39958171 TGAGGGAAATGGGGAGCCACGGG + Intergenic
1190534202 X:51409229-51409251 GTCAGGAAATGGGGAACAGCAGG + Intergenic
1190607256 X:52157409-52157431 TGTGGGAAATGGGGAAATGTTGG - Intergenic
1192561773 X:72131985-72132007 GGCGGGCCTTGGGGAACCGCGGG + Intergenic
1198343098 X:135733801-135733823 TTCGGGTAAAGGGGAACCTCGGG + Intergenic
1198344891 X:135749494-135749516 TTCGGGTAAAGGGGAACCTCGGG - Intergenic