ID: 1177864153

View in Genome Browser
Species Human (GRCh38)
Location 21:26492883-26492905
Sequence TTCTATGAGATCAGAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177864153 Original CRISPR TTCTATGAGATCAGAGAGGA CGG Intronic
900720639 1:4173674-4173696 TTCACTGAGATCAGAAAGGAGGG - Intergenic
900826716 1:4932909-4932931 TTCTATGTGGACTGAGAGGAAGG - Intergenic
903294650 1:22336021-22336043 TTCTGTGTGATCAGTGAGGTGGG + Intergenic
905682975 1:39887698-39887720 TTCTGTGAGGCCAGAGGGGAAGG + Intergenic
906446460 1:45903638-45903660 TTCCATGAGGTCTGAGAAGATGG + Intronic
906888601 1:49681690-49681712 TGCTGTGAAATCAGAGAGGCTGG - Intronic
907486643 1:54782528-54782550 TTCATTTAGAGCAGAGAGGAAGG - Intronic
907721750 1:56978567-56978589 TTCTTGGAGATCTCAGAGGATGG - Intergenic
909773490 1:79456118-79456140 TGATATGAGATCAGAGAAGTAGG - Intergenic
909804969 1:79863113-79863135 TTGTCTAAGATGAGAGAGGATGG + Intergenic
910148923 1:84117336-84117358 TTCCAAAAGATCAAAGAGGAAGG - Intronic
910555596 1:88528873-88528895 CTCTTTGAGAGCAGAGACGATGG - Intergenic
911207692 1:95108902-95108924 TTTTAAAAGATCAGTGAGGAAGG - Intergenic
911905838 1:103567764-103567786 TGAGATGAGATCAGAGAGGTAGG - Intronic
912068708 1:105779924-105779946 GTCTGTGAGAGCAGACAGGAGGG + Intergenic
912545712 1:110449876-110449898 ATTTATGAGTGCAGAGAGGAAGG - Intergenic
912558882 1:110536105-110536127 TGCTATGGGATCACAGAGGAGGG + Intergenic
912782408 1:112564046-112564068 TTCTATGAGATTGGACAGGCAGG + Intronic
913024221 1:114819904-114819926 TTCTATGAAAGCAGAGAAGAGGG - Intergenic
913265125 1:117036002-117036024 GTCCATGTGAGCAGAGAGGAGGG - Intronic
914799386 1:150949346-150949368 TTCTAGGAGATTAGAGAAGAGGG - Intronic
914820161 1:151095601-151095623 TGCTATGGGAGCACAGAGGAGGG - Intronic
915487714 1:156233634-156233656 ATCTCTGACATCAAAGAGGAGGG + Exonic
915581636 1:156816440-156816462 TTCTCAGAGAGGAGAGAGGAGGG - Intronic
916483240 1:165234411-165234433 TGCTATGAGATCATAGAGTCTGG - Intronic
917383169 1:174437226-174437248 TTTGATGAGTTGAGAGAGGAAGG + Intronic
919186178 1:194153813-194153835 GTCTATGAGACCAGATGGGAGGG + Intergenic
919742066 1:200987077-200987099 CTCGTTGAGATCAAAGAGGACGG - Exonic
919960024 1:202457684-202457706 TGCTATGAGAGCATAGAGGAGGG + Intronic
920204555 1:204282136-204282158 TCCTATGAGAGGAGATAGGAAGG + Intronic
920890215 1:209978189-209978211 TTCGATGAGTTGAGAGAAGAAGG - Intronic
921307039 1:213807760-213807782 TTTGATGAGATGAGAGAAGAAGG - Intergenic
922032504 1:221815309-221815331 TTCTATGAGAAAGGTGAGGAAGG + Intergenic
922292429 1:224219605-224219627 GTCTATGAGAACAAAGGGGATGG + Intergenic
922678413 1:227568467-227568489 TTCTTTGAGAACATAAAGGATGG + Intronic
923123909 1:231019218-231019240 GTCTATCAGATACGAGAGGAAGG - Exonic
923218255 1:231870034-231870056 TTATAGGAGATCTGAGAGTACGG + Intronic
923278395 1:232418248-232418270 TGCAATGAGAACAGAGGGGATGG + Intronic
923851490 1:237800961-237800983 TGCTATGAGAACTGAGGGGAAGG + Intronic
924073876 1:240312467-240312489 TTTCATCAGATCAGAGAGAATGG - Intronic
924838358 1:247678677-247678699 TTCGAAGTGATCAGAGAGGTAGG + Intergenic
1062913024 10:1226393-1226415 TTTGATGAGTTCAGAGAAGAAGG - Intronic
1062922051 10:1287874-1287896 AGCTGTGAAATCAGAGAGGAAGG - Intronic
1063786662 10:9392575-9392597 TTCGATGAGATAAAAGAGAAGGG + Intergenic
1064845805 10:19651759-19651781 TGCCATGAGATCAGAGAGTGGGG + Intronic
1065070001 10:22013771-22013793 TTATTTGACATCAGGGAGGATGG + Intergenic
1065173715 10:23056834-23056856 TTTTAAGGGATCAGAGAGAATGG + Intergenic
1065753182 10:28907211-28907233 TCCTAAGATAGCAGAGAGGAAGG + Intergenic
1066291106 10:34015196-34015218 ATCTATAACATCAGTGAGGAAGG - Intergenic
1068216076 10:53984075-53984097 TTCTATGAAACCAGATAAGAGGG - Intronic
1068775531 10:60864147-60864169 TTCCATGAGACCAGTAAGGAAGG - Intergenic
1068875158 10:61987902-61987924 TTTTATGAGAAAAGAGAGGTAGG + Intronic
1071100678 10:82033815-82033837 TTTTCTGGGATCAGAGAGTAAGG - Intronic
1072349437 10:94543115-94543137 TTTTAAGGGATCAGAGAGCAAGG + Intronic
1073586391 10:104714798-104714820 TTGTATGGGCTCAGAGAGAAAGG - Intronic
1073871436 10:107869361-107869383 ACCTAGGAGATCAAAGAGGACGG + Intergenic
1075096144 10:119472824-119472846 TTCAATGAGGTCAGTCAGGAAGG + Intergenic
1076144890 10:128110234-128110256 TTCAATTAGAACAGAGAAGACGG + Intronic
1077212458 11:1378077-1378099 TTCCAGGAAATCAAAGAGGAGGG + Intergenic
1078990600 11:16642898-16642920 TTTGATGAGTTCAGAGAAGAAGG - Intronic
1079453145 11:20614915-20614937 AGGGATGAGATCAGAGAGGAAGG + Intronic
1079614512 11:22474803-22474825 TTCTCTGAGAACACATAGGAAGG + Intergenic
1080707693 11:34713455-34713477 CTCTATTAGAACAGTGAGGAGGG + Intergenic
1081257208 11:40911703-40911725 TTTTATGAGTTGAGAGAAGAAGG + Intronic
1081289998 11:41313019-41313041 TTCTATGAGATCAGAAAGAGAGG - Intronic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1082232075 11:49780108-49780130 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1082660592 11:55905156-55905178 TTCTATTTGATCAGGGAAGAGGG - Intergenic
1082956525 11:58876274-58876296 TTTGATGAGTTGAGAGAGGAAGG - Intronic
1084704691 11:70809318-70809340 TTCTATGAGGACAGGGAGGAAGG + Intronic
1084904562 11:72335624-72335646 ACCTATGGGAGCAGAGAGGATGG - Intronic
1085662505 11:78382163-78382185 TGCCATGAGAGCACAGAGGAGGG - Intronic
1085712792 11:78845080-78845102 CTCCATGGGAGCAGAGAGGAGGG - Intronic
1086055693 11:82643429-82643451 TTCTATGGGAACAGAGAGACTGG - Intergenic
1086142739 11:83517505-83517527 TTCGATGAGTTGAGAGAAGAAGG - Intronic
1086301091 11:85426784-85426806 TTCAATGAGTTGAGAGAAGAAGG + Intronic
1086653188 11:89318240-89318262 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1087577533 11:100008551-100008573 TTCTTTGAGAACAGAGACTATGG - Intronic
1088892555 11:114056856-114056878 TTCTAAGAGATCATACAGGAAGG - Intergenic
1089641604 11:119851339-119851361 TTCTGGCAGATGAGAGAGGATGG - Intergenic
1090130736 11:124138947-124138969 TTCTATGTGATGAGAGATAAGGG + Intronic
1091338287 11:134790199-134790221 TACTGTGTGATGAGAGAGGAAGG - Intergenic
1091961244 12:4696454-4696476 TTCTGGGGAATCAGAGAGGAGGG + Intronic
1092207431 12:6623643-6623665 TTCTATGAGCTCAGTAAGCAAGG - Intronic
1092415410 12:8287131-8287153 TTCTATGAGGTCACAAAGGAGGG - Intergenic
1092479741 12:8849133-8849155 TTCCATGAGATCAATCAGGAGGG + Intronic
1092707342 12:11298676-11298698 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1093090544 12:14915395-14915417 TTCTTTGGGCTCAGAGAGGGAGG - Intronic
1093980200 12:25467468-25467490 CTATAAGAGATCAGGGAGGAGGG + Intronic
1095191352 12:39261559-39261581 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1095523914 12:43102510-43102532 TTCTTTCAGATCAATGAGGAGGG - Intergenic
1097191645 12:57222284-57222306 TTGTCTGAGATCAGAGATGGGGG + Intronic
1097736312 12:63185261-63185283 TTCTATGATAATGGAGAGGAAGG - Intergenic
1098916992 12:76267700-76267722 TCCTAAGAGATCAGAGAAGATGG - Intergenic
1099437052 12:82657812-82657834 TACTATTAGAACAGAGATGAAGG - Intergenic
1100978428 12:100145496-100145518 TGCTATAAGAACACAGAGGAAGG + Intergenic
1101392428 12:104314134-104314156 TGAGATGAGACCAGAGAGGAAGG + Intronic
1102507008 12:113390075-113390097 ACCTATGAGATCAGACAGGGAGG + Exonic
1103232525 12:119343818-119343840 TTCTAATACATCAGGGAGGAAGG + Intronic
1103718679 12:122961667-122961689 CCCCATGAGATCAGAGAGGGTGG + Intronic
1104150362 12:126076037-126076059 CTCTATGACATGAGAGGGGAGGG - Intergenic
1104467488 12:129002753-129002775 ATGCATGAGATCAGAAAGGATGG - Intergenic
1106387173 13:29299117-29299139 TTGCATGAGATCAGAGAGACAGG + Intronic
1107047833 13:36013212-36013234 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1107387261 13:39925767-39925789 TCCTATGAAATCAGTGAGGTAGG + Intergenic
1108686095 13:52819977-52819999 TACTATGTCATCAGAGAGAATGG + Intergenic
1109357709 13:61252835-61252857 TTCTATAAGATCTTAAAGGATGG + Intergenic
1109547359 13:63846056-63846078 CTCTATGAGATAAAAGAGAAAGG - Intergenic
1109691633 13:65899978-65900000 TTCCAAAAAATCAGAGAGGAAGG - Intergenic
1110163484 13:72408063-72408085 TTCTCTCAGAGCAGAGGGGAGGG + Intergenic
1110246125 13:73326664-73326686 TACTCAGAGACCAGAGAGGAAGG - Intergenic
1111761126 13:92466414-92466436 GTCTCTGAGATCAGACAGGGAGG - Intronic
1111965318 13:94856257-94856279 CTCTATGTGGACAGAGAGGAGGG + Intergenic
1113639768 13:111949087-111949109 TGCTGTGAGATCACAGAGGAAGG + Intergenic
1115072363 14:29339757-29339779 TGCTATAAGATCAGAGAGCTTGG - Intergenic
1116284828 14:42958216-42958238 TTTGATGAGCTCAGAGAAGAAGG - Intergenic
1116684456 14:48019576-48019598 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1116804715 14:49481613-49481635 TGCTATGAGCTCAAAGAGGAGGG - Intergenic
1117024006 14:51601292-51601314 TTCTATGAGACCTCAGAGAAGGG + Intronic
1117042994 14:51784924-51784946 TTCTAAGAGATCCGAGAAGCTGG - Intergenic
1117064779 14:52001719-52001741 TTCTATGAGCCCAGAGAATAAGG - Intronic
1117522100 14:56561140-56561162 TTCTAAGAGATCCTAGGGGATGG + Intronic
1117835179 14:59797246-59797268 TTCTATAAGCACAGAGAGTATGG + Intronic
1118022673 14:61734757-61734779 TTCTATGAGATTAGGGAGGGGGG + Intronic
1118538644 14:66797895-66797917 TTCTACCAGATCTTAGAGGAAGG + Intronic
1119313798 14:73674149-73674171 TGAAATGAGATCAGAAAGGAAGG - Intronic
1119675611 14:76551279-76551301 TTTTTTGAGAGCACAGAGGAGGG - Intergenic
1120416241 14:84221715-84221737 TTCTGTGATATAGGAGAGGAGGG + Intergenic
1124257769 15:28159716-28159738 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1124711224 15:32014007-32014029 ATCTATGTGATTAGAGAAGAGGG - Intergenic
1125034916 15:35112225-35112247 TGCTGTGGGATCAGAAAGGAAGG + Intergenic
1125456635 15:39867115-39867137 TACTCTGAGAGTAGAGAGGAAGG + Intronic
1126528103 15:49680435-49680457 TACTATGAGAGCATAGAGAAGGG - Intergenic
1126779291 15:52124893-52124915 TGCTATGGGACCAGAGAGGAAGG + Intronic
1127273958 15:57426084-57426106 CTCCTGGAGATCAGAGAGGAAGG + Intronic
1127669951 15:61185831-61185853 TGATAAGAGATCAGAGAGAAGGG - Intronic
1129556394 15:76514551-76514573 TTCTTTGTGATCAGGGAGGAAGG + Intronic
1130645371 15:85721044-85721066 TTAGATGAAACCAGAGAGGAGGG - Intronic
1130707184 15:86244335-86244357 TTCTGGAAGATCTGAGAGGAAGG - Intronic
1131304079 15:91225854-91225876 TGCTCTGAGAACAGAGAGAAGGG - Exonic
1132203825 15:99973094-99973116 CTCTTTGAGAGCACAGAGGATGG - Exonic
1132506992 16:315529-315551 TTCTATGAAATCAGACAGGCCGG + Intronic
1137612071 16:49824887-49824909 TTCTTTTGCATCAGAGAGGAGGG - Intronic
1137910629 16:52374213-52374235 TTCTGTGAGATGCGAGAGGATGG - Intergenic
1138118600 16:54380095-54380117 ATCTGTGTGATTAGAGAGGAGGG + Intergenic
1139646561 16:68335456-68335478 TGATGTGACATCAGAGAGGATGG + Intronic
1140496592 16:75394460-75394482 TCCTCTAAGATCACAGAGGATGG + Intronic
1140607633 16:76560300-76560322 TGCTATGAGAAAAGAGAGGCAGG - Intronic
1141894327 16:86948906-86948928 TGGTTTGAGAACAGAGAGGAGGG - Intergenic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1142258111 16:89025347-89025369 TTTCTTGAGATCAGAGAGCAGGG - Intergenic
1144017445 17:11209475-11209497 CTCTATGAGGGCAGAGACGAGGG - Intergenic
1144263007 17:13541554-13541576 TTCTCTGAGATTTGAGAGGGTGG + Intronic
1144263505 17:13546092-13546114 TTTTATGAAGTCAGAGAGGGCGG - Intronic
1147902388 17:43797477-43797499 TTCGATGAGTTGAGAGAAGAAGG - Intergenic
1148382785 17:47211750-47211772 TTCTCGGAGATGAGACAGGATGG + Intronic
1148845914 17:50529713-50529735 CTCTAGGGGAACAGAGAGGAAGG + Intronic
1148990758 17:51665102-51665124 ATCTATTAGATAACAGAGGAGGG + Intronic
1150569045 17:66369697-66369719 TTCTGGGAGAACAGAGGGGATGG + Intronic
1150918136 17:69457063-69457085 TTGATTTAGATCAGAGAGGATGG - Intronic
1152602623 17:81272401-81272423 TTTTAAGAGACCAGAGAAGATGG + Intronic
1155215753 18:23641708-23641730 TTTTATGGGCTCAGAAAGGAGGG - Intronic
1155334125 18:24747824-24747846 TTCTATGGGACTTGAGAGGAAGG - Intergenic
1156980921 18:43287072-43287094 TTTGATGAGTTCAGAGAAGAAGG + Intergenic
1157153901 18:45246099-45246121 TTCAATGAGGTCATAAAGGAGGG + Intronic
1157203650 18:45680313-45680335 TTCTCTGAAAACAGAGAGAAAGG - Intronic
1158404490 18:57148900-57148922 ATCTATGGGAGCACAGAGGAAGG - Exonic
1159117361 18:64130630-64130652 GTCTATGGAAACAGAGAGGAGGG + Intergenic
1159653119 18:71000627-71000649 GTGTATGAGAACAGAGAGGGAGG + Intergenic
1160044124 18:75371058-75371080 TTGCAGGAGGTCAGAGAGGAGGG - Intergenic
1160335063 18:78031481-78031503 TTCTGTGTGTTCTGAGAGGACGG - Intergenic
1160431418 18:78815597-78815619 TTCTAGCTGAACAGAGAGGAAGG + Intergenic
1164767511 19:30783089-30783111 TTTTATCAAATCAGAGAGGATGG - Intergenic
1165270702 19:34705366-34705388 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
1167578600 19:50329322-50329344 TTCTAAGAGAGCAGGGAGGAGGG + Exonic
1167932472 19:52877395-52877417 TTATATGTGAGCAGGGAGGAGGG + Exonic
1167954555 19:53054223-53054245 TTCTTTGCCATCGGAGAGGATGG - Intergenic
1168095905 19:54114785-54114807 TTCTAGGATCTCAGGGAGGAGGG - Intronic
1168115708 19:54220490-54220512 GCCTTTGAGCTCAGAGAGGACGG + Intronic
1168118694 19:54240236-54240258 GCCTTTGAGCTCAGAGAGGACGG + Intronic
1168326408 19:55540931-55540953 TCCTATGAGGACAGGGAGGAGGG - Exonic
925709825 2:6727840-6727862 TTCTATTAGATCACTTAGGAGGG - Intergenic
926000122 2:9323860-9323882 TTCTCTGAGATCAGAGACCATGG + Intronic
926304643 2:11629081-11629103 TTCTTTGGGAGCAGAGATGAGGG - Intronic
926702642 2:15813928-15813950 TTCCTTGAGACAAGAGAGGAAGG - Intergenic
926986378 2:18629055-18629077 TTCTATGATTTCAGTGAGGTGGG - Intergenic
927004842 2:18837216-18837238 GTCTATGAGAACAGAGAGGAAGG - Intergenic
927459996 2:23290334-23290356 TTATGTGAGATTAGAGAGGAAGG + Intergenic
928837742 2:35568039-35568061 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
930045748 2:47170766-47170788 TACAAAGAGATCAAAGAGGAAGG + Intronic
931095874 2:58940234-58940256 TTTTATAAAATCAGAGAAGAAGG - Intergenic
931221981 2:60296445-60296467 GTCTTTGGCATCAGAGAGGAAGG - Intergenic
931325438 2:61217177-61217199 TTCTTTAAGAACAGACAGGAAGG + Intronic
933023193 2:77220363-77220385 TTCTACGAGTTGAGAGAAGAAGG + Intronic
933590403 2:84225889-84225911 TTTGACGAGATGAGAGAGGAAGG + Intergenic
935528407 2:104201480-104201502 TTATATGAGATAAAAGAGAAGGG - Intergenic
935558882 2:104540950-104540972 TCCTTTGACATCTGAGAGGAGGG + Intergenic
937430368 2:121832863-121832885 TTCTATGGGATCCAGGAGGAGGG + Intergenic
937508401 2:122563534-122563556 TACTGTGAGAACAAAGAGGAGGG + Intergenic
937750802 2:125474529-125474551 TTCTATGAGATCTGAAAGATAGG - Intergenic
937863856 2:126733312-126733334 TTCTGTGAGGGCAGGGAGGAGGG + Intergenic
938315099 2:130319425-130319447 TTGTAAGAGATCAGAGAGCTTGG - Intergenic
938588278 2:132712853-132712875 TGTTATGGGATCACAGAGGAGGG + Intronic
938901656 2:135803662-135803684 CTCTCTGAGATCAGAGATGTGGG - Intronic
939318019 2:140577940-140577962 TTGAAAGAGATTAGAGAGGAAGG - Intronic
940886995 2:158998851-158998873 TCCCAAGAGATCAGAGGGGAGGG - Intronic
941045007 2:160664916-160664938 GGCTATGAGATCAGAAAAGAAGG + Intergenic
941890557 2:170576762-170576784 TGCTAAGAGATCATAGAGTAAGG - Intronic
942215319 2:173713623-173713645 TTCTCTGAGATCGGAGGGGAGGG - Intergenic
944007785 2:194931828-194931850 TTCTATGAGACCAGGCAGGATGG + Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
945677836 2:212876837-212876859 TTTGATGAGTTCAGAGAAGAAGG + Intergenic
946323916 2:218972999-218973021 TTCCTTGAGGTCAGAGAAGAAGG - Intergenic
947036144 2:225859071-225859093 ATCCATGAGATCAGTGTGGATGG - Intergenic
947257489 2:228181801-228181823 TCCTGCAAGATCAGAGAGGACGG - Intergenic
947435558 2:230069091-230069113 TTCTCTGAGATGGGAGAGAAGGG + Intergenic
947529297 2:230898696-230898718 TGCCATGGGATCACAGAGGAGGG + Intergenic
947679345 2:232015892-232015914 TGCTCTGAGATTTGAGAGGAGGG + Intronic
948233752 2:236371175-236371197 TTCTAGAAGATGAGAGAGGGTGG - Intronic
948381575 2:237553810-237553832 TTCTCACAGATCAGAGAGGATGG - Exonic
1169861214 20:10154666-10154688 TTCTATGAGATGAGTGAGGCTGG - Intergenic
1171055461 20:21902519-21902541 TTCAGTGAGATGAGAGAGGTTGG - Intergenic
1171814192 20:29768843-29768865 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1172437990 20:34943665-34943687 TTCTATGAGAACACATAGTAGGG - Intronic
1173296596 20:41764660-41764682 TTCTCTGAGACCAGAGGGGATGG + Intergenic
1174776219 20:53345463-53345485 TTGTAAGAAATCATAGAGGAAGG + Intronic
1176510866 21:7746572-7746594 TTCTGTGATATCAGAGAGGATGG + Intronic
1177025693 21:15919563-15919585 TTCGATGAGTTGAGAGAAGAAGG - Intergenic
1177304576 21:19296601-19296623 CTCAAAGAAATCAGAGAGGAAGG + Intergenic
1177864153 21:26492883-26492905 TTCTATGAGATCAGAGAGGACGG + Intronic
1178644979 21:34377101-34377123 TTCTGTGATATCAGAGAGGATGG + Intronic
1178668477 21:34569512-34569534 ATCTATGAGCTCAGACAGAAAGG + Intronic
1178694994 21:34785433-34785455 TTCTATTATATCAGTCAGGAAGG + Intergenic
1179091442 21:38269735-38269757 CTCTCTGAAACCAGAGAGGAGGG + Intronic
1179525752 21:41974841-41974863 TTCGATGAGAGAGGAGAGGAGGG + Intergenic
1180317648 22:11289425-11289447 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1181381216 22:22506126-22506148 ATCTATGAGATCAGAGCCCAAGG + Intronic
1181917328 22:26291783-26291805 TGCTAAGAGAGCAGAGAGGACGG - Intronic
1182791723 22:32958743-32958765 TTTTATGAGATCACATAGCAGGG + Intronic
1183415887 22:37681615-37681637 CTCTATGAGGTCAAAGAGGATGG + Intergenic
949717434 3:6950040-6950062 TTTGATGAGTTGAGAGAGGAAGG - Intronic
949819342 3:8099296-8099318 TTCAATGAGATCATAGAGAAGGG - Intergenic
951823302 3:26838396-26838418 ATCTATGTGACGAGAGAGGAGGG + Intergenic
952068516 3:29602964-29602986 TTCTATGAGAACAGATAAAAAGG - Intronic
952104295 3:30051270-30051292 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
952824507 3:37513847-37513869 TTTTCTGAGATCAGGGATGAGGG + Exonic
952837614 3:37617946-37617968 TTTGATGAGTTCAGAGAAGAAGG - Intronic
953440628 3:42913746-42913768 CACTATGAGAACAAAGAGGAGGG + Intronic
956330127 3:68097582-68097604 TTCAATAAGATATGAGAGGAAGG + Intronic
957102843 3:75849980-75850002 TTTGATGAGCTCAGAGAGGAAGG - Intergenic
958049987 3:88333102-88333124 TTTTCTGTGATCAGATAGGATGG + Intergenic
960231653 3:115235092-115235114 ATCAATGAGGTCAGAGAAGAGGG + Intergenic
963025190 3:140912386-140912408 TTCTAAGAGATGAGAGAGGGAGG - Intergenic
963512458 3:146265264-146265286 TTCTATCAGTTCAGAAATGATGG - Intergenic
966479661 3:180392508-180392530 TTCAGTGCTATCAGAGAGGAAGG - Intergenic
966542366 3:181106393-181106415 TTCTATGTGTTCAAAGATGATGG - Intergenic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
967099822 3:186207128-186207150 TTCTATGAGACCACAAAGGAAGG - Intronic
967198392 3:187049431-187049453 TTCTATGAGATCCAAGGGAAGGG + Intronic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
967982078 3:195071792-195071814 CACCATGACATCAGAGAGGAGGG + Intronic
969829590 4:9783696-9783718 TCCTATGAGAGAAGAGAGTATGG + Exonic
970124241 4:12791608-12791630 TTCTATGAGAACAGGAAAGAGGG - Intergenic
970597162 4:17611000-17611022 ATCTAGGAGTGCAGAGAGGATGG - Intergenic
970608879 4:17707546-17707568 TGCTAAGGGAGCAGAGAGGAGGG - Intronic
971369196 4:26002245-26002267 TTTTATGAGACTAGAGAGAAGGG - Intergenic
971468126 4:26987494-26987516 TTCCAGGAGATGAGAGAGTATGG - Intronic
972320633 4:37970568-37970590 TTCGATGAGTTCCCAGAGGAAGG - Intronic
972702551 4:41508143-41508165 TGGTATGAGATCAGTGTGGATGG + Intronic
973055463 4:45652327-45652349 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
973283533 4:48388999-48389021 TGTTATGAGACCAGTGAGGAAGG + Intronic
973679272 4:53299102-53299124 TTTGATGAGTTGAGAGAGGAAGG + Intronic
974240952 4:59246236-59246258 CACTCTGAGAGCAGAGAGGATGG + Intergenic
974659177 4:64864130-64864152 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
975094874 4:70446052-70446074 CTCTAAGAGATCTGGGAGGAAGG + Intronic
975287358 4:72636327-72636349 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
977933236 4:102771586-102771608 TTCAAGGAAATCAGGGAGGAGGG + Intergenic
978300475 4:107264236-107264258 GTTTATGAGATCAAAGTGGAAGG + Intronic
978951664 4:114568083-114568105 TACTTTGAGAACAGACAGGAAGG - Intergenic
978998449 4:115185196-115185218 TGCTAATAGATCAAAGAGGAGGG + Intergenic
980194567 4:129571996-129572018 ATCTATATGATCAGATAGGAAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981571038 4:146150824-146150846 TTCTCTTAGATGAGACAGGAAGG + Intergenic
983297677 4:165886833-165886855 TTCTATGGTAGCACAGAGGAGGG + Intronic
983524795 4:168749872-168749894 GTCTATGAGAGGAGAGGGGAGGG - Intronic
984541007 4:181036652-181036674 TTCTATGAGCACAGAGAGCTGGG + Intergenic
984590669 4:181613932-181613954 TTCTATTAGGCCAGAAAGGAAGG + Intergenic
986571110 5:9167294-9167316 TTCTTTGAAGCCAGAGAGGAAGG - Intronic
987765020 5:22214822-22214844 TTTTATGAGAACAGAAAGGCTGG - Intronic
987912736 5:24170026-24170048 TTCTTTGATATTAGAGAAGAGGG + Intronic
987961918 5:24822060-24822082 TTCTAAAACATCAAAGAGGAGGG - Intergenic
988341429 5:29977223-29977245 TTTTCTGAGGTCAAAGAGGAAGG - Intergenic
989253755 5:39344180-39344202 TTTGATGAGATGAGAGAAGAAGG + Intronic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
989784739 5:45313524-45313546 TTCGATGAGTTGAGAGAAGAAGG + Intronic
990135756 5:52642491-52642513 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
990794028 5:59519744-59519766 TGCTATGAGATTAGACTGGATGG + Intronic
990975673 5:61559508-61559530 GAGTCTGAGATCAGAGAGGAGGG - Intergenic
991383829 5:66062526-66062548 TTTGATGAGTTGAGAGAGGAAGG - Intronic
991617704 5:68514347-68514369 TTCTATGAAGGCAGTGAGGAAGG - Intergenic
992168293 5:74076642-74076664 TTTTATGAGATCAGAAGTGAGGG - Intergenic
992260557 5:74966123-74966145 TCCTCTTAAATCAGAGAGGAGGG - Intergenic
992559055 5:77932335-77932357 TCCTATCAGATCAGAATGGAAGG - Intergenic
993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG + Intergenic
994006044 5:94838461-94838483 TTCTCGGAGATCCAAGAGGAAGG - Intronic
994180558 5:96759297-96759319 TTCTATTATATCAAAGAGCATGG - Intronic
994488352 5:100408546-100408568 ATATGTGAGATCAGAGAGGCAGG - Intergenic
995189790 5:109308246-109308268 TTCTTTGAAATCAGGGAAGAGGG + Intergenic
995673524 5:114635169-114635191 TTGTATGAGATCACAGGGGAGGG - Intergenic
995725161 5:115174215-115174237 TGCTCTGAGATCAGACAGGCAGG + Intronic
995749953 5:115443033-115443055 TTTGATGAGTTCAGAGAAGAAGG + Intergenic
996515003 5:124359386-124359408 TTCGATGAGTTGAGAGAAGAAGG + Intergenic
996851871 5:127962175-127962197 TTAAATGAGATCATAGAGGTCGG - Intergenic
997816473 5:137023762-137023784 TTCTGTGAGAGCATAAAGGAAGG - Intronic
998316987 5:141191796-141191818 TTTTATGAGAGAATAGAGGAGGG + Intronic
998765249 5:145479177-145479199 TTTTAAGGGATCAGAGAGCAAGG - Intronic
999189964 5:149739875-149739897 TTCACAGAGCTCAGAGAGGAGGG + Intronic
999507027 5:152208321-152208343 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
999636015 5:153623254-153623276 TTCCCTGGGTTCAGAGAGGAGGG + Intronic
1000013346 5:157254490-157254512 TTCCCTGATATAAGAGAGGATGG + Exonic
1000525199 5:162349024-162349046 TTGTATGAGGTGAGAGATGAGGG + Intergenic
1001237688 5:170043997-170044019 TACTTTGAGAGCAGAGAGGAGGG + Intronic
1003348297 6:5291997-5292019 TGCTGTGAGGTCAGAAAGGAGGG + Intronic
1003451484 6:6237654-6237676 TACTATGTGATCAAAGAGTAAGG - Intronic
1004776806 6:18856684-18856706 TTCAATGAGATCCAAGAGAAAGG - Intergenic
1005073828 6:21887956-21887978 TTCTATGAGCTAAGTCAGGAGGG - Intergenic
1006654976 6:35583166-35583188 TTCACTGAGATGAGATAGGAAGG + Intronic
1006884897 6:37373152-37373174 TTCTTGGAGATTGGAGAGGAAGG - Intronic
1007970886 6:46051073-46051095 TTCTAAGAGTTCAGAGATGGGGG - Intronic
1008565422 6:52763381-52763403 TTCTAGGAGGCTAGAGAGGAGGG + Intronic
1008569616 6:52803722-52803744 TTCTAGGAGGCTAGAGAGGAGGG + Intronic
1009503725 6:64449013-64449035 TTTGATGAGTTGAGAGAGGAAGG + Intronic
1010523794 6:76876029-76876051 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1011037728 6:82996194-82996216 TTTTGTGAGATCAGAAAGCAAGG + Intronic
1011200525 6:84831412-84831434 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
1012343169 6:98153977-98153999 TCCTATGAAATCAGAAGGGAGGG + Intergenic
1012724642 6:102795028-102795050 TTCTTTGAGCCCAGAGAGGAGGG + Intergenic
1014455370 6:121627492-121627514 TTGAAAGAGATCACAGAGGAAGG - Intergenic
1014823277 6:126017706-126017728 TATTATGAGAGCACAGAGGATGG - Intronic
1014901784 6:126974586-126974608 TTCTATGAGAAGAGAAATGACGG + Intergenic
1015050997 6:128839963-128839985 TGCTATGAGAGCAGAGAGGTTGG + Intergenic
1015062366 6:128981943-128981965 TGCTATGAGAGCAGAGAGGTTGG - Intronic
1015101119 6:129481893-129481915 TTCTTTGTGTCCAGAGAGGATGG - Intronic
1017318920 6:153065577-153065599 TTCATTGAGATCAGAAAAGATGG - Intronic
1018398058 6:163395991-163396013 TTCACTGAGAACAGAAAGGAAGG + Intergenic
1019169441 6:170123917-170123939 ATCTCTGAAGTCAGAGAGGAAGG + Intergenic
1020593151 7:10168619-10168641 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1021661721 7:22925339-22925361 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1022345085 7:29506713-29506735 TCCTAGGGGATCAGGGAGGAAGG + Intronic
1023050583 7:36247737-36247759 TTAAATGAGATCACAGAAGATGG - Intronic
1023324416 7:39037475-39037497 TTCTTTGATTTCAGAGATGAAGG + Intronic
1023419707 7:39966597-39966619 TTCGACGAGTTCAGAGAAGAAGG - Intronic
1023507432 7:40914870-40914892 ATATCTGAAATCAGAGAGGAAGG + Intergenic
1025094585 7:56087450-56087472 TTCTATCAGAGCAGTGAGGGTGG + Intronic
1026065494 7:67068433-67068455 TTCTATTAGATCTGATAGTAAGG - Intronic
1026711380 7:72743428-72743450 TTCTATTAGATCTGATAGTAAGG + Intronic
1027990373 7:85352054-85352076 ATCTGTGGGATCAGAGATGATGG + Intergenic
1028572698 7:92308781-92308803 TTCTATGAGATATGTAAGGATGG - Intronic
1029425090 7:100489791-100489813 TTCTAGGAGACCAGAGAGGTGGG + Intronic
1030457882 7:109796125-109796147 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1030467714 7:109924069-109924091 TTCAATGAGTTGAGAGACGAAGG - Intergenic
1030493731 7:110271094-110271116 TTCTCCAAGATCAAAGAGGATGG + Intergenic
1030510158 7:110473361-110473383 TTCGATGAGTTTAGAGAAGAAGG + Intergenic
1032388734 7:131541958-131541980 TTTCATGACATCAGAGAGGGGGG + Intronic
1032505359 7:132430425-132430447 TCCTATGCAAGCAGAGAGGAGGG + Intronic
1033577027 7:142695290-142695312 TTTTAAGGGATCAGAGAGCAAGG + Intergenic
1034445380 7:151111366-151111388 TTCGAGGAGATGAGGGAGGATGG - Intronic
1034731626 7:153392202-153392224 TACCATTAGAACAGAGAGGAAGG + Intergenic
1034910036 7:154988345-154988367 TTCTATGAGCTTAGGAAGGATGG - Intronic
1036629084 8:10497682-10497704 TTCTATGAGTTCTGAAAAGAGGG + Intergenic
1037083328 8:14814614-14814636 TTTTAAGAGTTCAGAGAAGATGG + Intronic
1037483977 8:19330302-19330324 TTCAATGAGCTCAGAGAGTGGGG - Intronic
1039271419 8:35884820-35884842 TTCTCTGAAAACAGAGGGGAAGG + Intergenic
1039589240 8:38733113-38733135 CTCTAGGAGAGCAGAGAGAAAGG - Intronic
1040062048 8:43112074-43112096 TTTGATGAGTTGAGAGAGGAAGG + Intronic
1041202293 8:55461632-55461654 TTTGATGAGTTGAGAGAGGAAGG + Intronic
1041529956 8:58854307-58854329 TTTTAATATATCAGAGAGGATGG + Intronic
1041846859 8:62339227-62339249 TTGTCTGAGATGAGAGAGAAAGG + Intronic
1042362163 8:67895086-67895108 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1044104698 8:88189196-88189218 TGCTATGAGCTCAGTAAGGAAGG - Intronic
1044361839 8:91294905-91294927 TGCTATGAGACCACAGAGGGTGG + Intronic
1044534174 8:93340525-93340547 TTCTCTGAAAACAGTGAGGAAGG - Intergenic
1044942186 8:97354487-97354509 TTCTATGGGATGACAAAGGAAGG - Intergenic
1045203610 8:100013301-100013323 TTAAATGAGAACAGAGAAGAGGG + Intronic
1045336899 8:101213260-101213282 TTCAATAAGTTCAGTGAGGAAGG - Intergenic
1045810474 8:106215202-106215224 TTCTCTGAGATGGGAGAGAAGGG - Intergenic
1045957360 8:107924383-107924405 TTCTTTGAAAAGAGAGAGGAGGG + Intronic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047819708 8:128505222-128505244 GCATATGAGAACAGAGAGGAAGG - Intergenic
1050928177 9:11292382-11292404 TTCAAAGAAATCAGAGATGATGG - Intergenic
1051525087 9:18033978-18034000 TACTCTGAGAGAAGAGAGGAGGG - Intergenic
1052890518 9:33695172-33695194 TTTTAAGGGATCAGAGAGCAAGG + Intergenic
1055762384 9:79622648-79622670 TTCTATGAGATCAAAGACTATGG + Intronic
1056054472 9:82806638-82806660 TATTATGAGAACAAAGAGGAAGG - Intergenic
1056297898 9:85211255-85211277 TTCTATGGGATCACAGAGGTGGG + Intergenic
1057733422 9:97631920-97631942 GTAGATGAGATCAGAGAGGTAGG - Intronic
1057736598 9:97668006-97668028 TTCTGTGATATCCGAGAGCAGGG + Intronic
1059200095 9:112406762-112406784 TTTTAAGAAATCAGAGAGGCCGG - Intronic
1060856715 9:126919885-126919907 TTGTGTGAGATCACAGAGGCAGG + Intronic
1203365876 Un_KI270442v1:255161-255183 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1186348782 X:8722019-8722041 TTGTATGAGATCTCAGAGGAGGG - Intronic
1186643157 X:11478917-11478939 TTCTATGAGTTCAAAGAGTTTGG - Intronic
1186798184 X:13066785-13066807 TACTATGAGAGCCTAGAGGAGGG - Intergenic
1187050417 X:15690401-15690423 TGCTATGGGACCACAGAGGAAGG + Intronic
1187835439 X:23428279-23428301 TTTGACGAGATGAGAGAGGAAGG - Intergenic
1189716135 X:43868452-43868474 CTCTATGAAATCAGAGAGAAAGG + Intronic
1190024144 X:46907326-46907348 TTCTATAATACCAAAGAGGAGGG + Intergenic
1190494651 X:51017640-51017662 TTTGATGAGTTCAGAGAAGAAGG - Intergenic
1190834910 X:54091672-54091694 TGCTATGAGAGCATAGAAGAGGG + Intronic
1190939593 X:55027710-55027732 TTCTATGAGATCAGGAAGGGAGG - Intronic
1191006978 X:55719821-55719843 TACTATGAGAGCACAAAGGAAGG - Intronic
1191064127 X:56329976-56329998 TTTGATGAGATGAGAGAAGAAGG - Intergenic
1191120185 X:56895062-56895084 TTCGATGAGTTGAGAGAAGAAGG + Intergenic
1192041895 X:67631624-67631646 TTTGATGAGATGAGAGAAGAAGG - Intronic
1192326357 X:70135491-70135513 TACTATGAGAGCAGACAGGAAGG + Intronic
1192335373 X:70215379-70215401 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
1192468632 X:71376994-71377016 TTCTCTGAGGCCAAAGAGGAAGG - Exonic
1192954202 X:76051779-76051801 TTTGACGAGTTCAGAGAGGAAGG - Intergenic
1193002869 X:76582815-76582837 TTCGATGAGCTGAGAGAAGAAGG - Intergenic
1193015191 X:76725015-76725037 TTCGATGAGCTGAGAGAAGAAGG - Intergenic
1193072437 X:77320024-77320046 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1193539665 X:82755789-82755811 ATCAATGAGACCAGAGAGAAAGG - Intergenic
1195006701 X:100692191-100692213 TGCTATGGGAGCACAGAGGAAGG - Intronic
1195167519 X:102235462-102235484 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
1195191339 X:102451625-102451647 TTTGATGAGTTGAGAGAGGAAGG + Intronic
1196604206 X:117637593-117637615 TGCTATGAGATCACAGAGGGAGG - Intergenic
1197181758 X:123544297-123544319 TACTATGAGACCATAAAGGAGGG + Intergenic
1197331816 X:125161993-125162015 TCCAATGAGATATGAGAGGAAGG + Intergenic
1197436028 X:126429449-126429471 GTCCATGAGGGCAGAGAGGATGG + Intergenic
1197574962 X:128200079-128200101 TTAGATGAGCTGAGAGAGGAAGG + Intergenic
1197637332 X:128929950-128929972 TGCTATTGGAGCAGAGAGGAGGG + Intergenic
1197965743 X:132059587-132059609 TATTATGAGATCAGAAGGGAAGG - Intergenic
1198013484 X:132584514-132584536 TTCTATGGTAGCAGAGAGTAAGG + Intergenic
1198103355 X:133440592-133440614 TTTTATGTGAGCAGGGAGGAAGG - Intergenic
1198649147 X:138841817-138841839 GTCTATGAGATCAGGAAAGAAGG - Intronic
1199029691 X:142982085-142982107 TTCTATGGACTCAGAGACGAGGG - Intergenic
1199397306 X:147354095-147354117 CTCGAGGAAATCAGAGAGGATGG + Intergenic
1199419202 X:147623878-147623900 ATCTGGGAGACCAGAGAGGAAGG + Intergenic
1199707582 X:150444074-150444096 TTCATTGACATCAGGGAGGATGG + Intronic
1200297837 X:154940172-154940194 TTTGATGAGTTGAGAGAGGAAGG + Intronic
1201171674 Y:11272984-11273006 TTTGATGAGTTGAGAGAGGAAGG - Intergenic
1201722298 Y:17112926-17112948 ATCCAAGAGGTCAGAGAGGAGGG - Intergenic
1201739948 Y:17312777-17312799 TTTGATGAGATGAGAGAAGAAGG + Intergenic
1201915177 Y:19173632-19173654 TTTGATGAGTTGAGAGAGGAAGG + Intergenic
1202035028 Y:20624161-20624183 GTCAAAGAGATCAGAGGGGAGGG - Intergenic