ID: 1177865440

View in Genome Browser
Species Human (GRCh38)
Location 21:26507539-26507561
Sequence ATCAGATGCTATGAGTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177865440_1177865443 20 Left 1177865440 21:26507539-26507561 CCTTTATACTCATAGCATCTGAT 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1177865443 21:26507582-26507604 AGGCAATTATTTAATAGCAATGG 0: 1
1: 0
2: 0
3: 51
4: 839
1177865440_1177865442 0 Left 1177865440 21:26507539-26507561 CCTTTATACTCATAGCATCTGAT 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1177865442 21:26507562-26507584 GAGGTCAGCATTAAGAAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177865440 Original CRISPR ATCAGATGCTATGAGTATAA AGG (reversed) Intronic
904914925 1:33962842-33962864 GTTAGATGCTATGAATAAAAAGG - Intronic
908231937 1:62113884-62113906 ATGAGCTGCTTTGAATATAAAGG - Intronic
909152346 1:72023794-72023816 ATAACATGGTAGGAGTATAAGGG + Intronic
909720187 1:78758768-78758790 ATCTGGTGCTATAAGTATAGTGG + Intergenic
911254654 1:95620184-95620206 AATAGATGCTATTAGTAAAAGGG + Intergenic
912008867 1:104935015-104935037 TTCAGATTCCATGACTATAAAGG + Intergenic
913977970 1:143480084-143480106 ATTAAATGCTAAGATTATAATGG - Intergenic
914072372 1:144305713-144305735 ATTAAATGCTAAGATTATAATGG - Intergenic
914106782 1:144660643-144660665 ATTAAATGCTAAGATTATAATGG + Intergenic
914389636 1:147208402-147208424 TTCAGATTCTATGAGTCTATAGG + Intronic
914952143 1:152125419-152125441 ATCAGATGCTTGGATTAGAAAGG - Intergenic
916925012 1:169509794-169509816 ATGATATACTATGAATATAATGG - Intergenic
916931159 1:169579212-169579234 GTCAAATGCTATTAATATAAGGG - Intronic
918370279 1:183854019-183854041 ACAAGATGCTGTGTGTATAATGG + Intronic
918562285 1:185883581-185883603 ATCAGATGCGCTAAGTAAAATGG - Intronic
922129793 1:222766354-222766376 TCAAGATGCTATGAATATAAGGG + Intergenic
1063178756 10:3576933-3576955 AGCCTATGCTATGAGCATAATGG + Intergenic
1068331235 10:55572703-55572725 TTCAGATGCTATGAGAAAACAGG + Intronic
1068443706 10:57093708-57093730 ATACGATGCTATCAGGATAAGGG + Intergenic
1071069543 10:81675537-81675559 CTCAGATGCTCTGAATACAAGGG - Intergenic
1072085566 10:92076182-92076204 AGGAGATGCTTTGAGTAAAAAGG + Intronic
1074177009 10:111017813-111017835 AACAAAAGCTATGAGGATAAAGG + Intergenic
1075892651 10:125966974-125966996 CAAAGATGCTATGATTATAATGG - Intronic
1076584476 10:131536059-131536081 ATTTTATGCTATAAGTATAAAGG - Intergenic
1078584027 11:12565075-12565097 TTCAGATGCTCCTAGTATAAAGG - Intergenic
1078822558 11:14896383-14896405 ATTAGATGCTGGGAATATAATGG + Intergenic
1079702578 11:23567031-23567053 ATGAGACGCCATGACTATAAAGG - Intergenic
1080610580 11:33900549-33900571 TCCAGATTCTATGAGTATAAAGG + Intergenic
1081472713 11:43391065-43391087 TTGAGATGCTATGAGAATATGGG + Intronic
1081830590 11:46109306-46109328 ATAAGATCCTATGTGTAAAAAGG + Intronic
1082089808 11:48080016-48080038 CTCAGATGCTGTGAGTCTGAGGG + Intronic
1090084783 11:123641345-123641367 ATCAGACGATATGACTAAAATGG - Intronic
1090183477 11:124720539-124720561 ATCAGATGCTGGGAATATAATGG + Intergenic
1092731427 12:11538628-11538650 ACCAGATGATATGAGTGCAATGG - Intergenic
1092808275 12:12247985-12248007 ATGAGATGATCTGAGGATAAAGG - Intronic
1095202325 12:39398781-39398803 ATAAGATGCATTGAGTATAAAGG + Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1098091395 12:66905949-66905971 AAGAGATGCTATTAGTAAAAAGG + Intergenic
1098365799 12:69701830-69701852 ATCTGATGTTATGTTTATAAAGG + Intergenic
1098935739 12:76477216-76477238 AACAGTTTCTAAGAGTATAAAGG - Intronic
1099147625 12:79066558-79066580 AGCAGAAGCTATGAGCAAAATGG + Intronic
1099337448 12:81381375-81381397 TTCAGAGGCTATTAGTATCAAGG + Intronic
1101674652 12:106907060-106907082 ATGAGATGCTATGGGGAAAAAGG + Intergenic
1102382300 12:112477420-112477442 ATCATATACTATGGGTATATAGG - Intronic
1105221379 13:18331374-18331396 ATTAAATGCTAAGATTATAATGG + Intergenic
1108056756 13:46493003-46493025 ATCAGAAGCAATGAGTCTCAAGG + Intergenic
1108428176 13:50326317-50326339 AGCAGGTGCTGTGAATATAATGG + Intronic
1108523744 13:51267710-51267732 AAGCGATGCTCTGAGTATAAGGG + Intronic
1109387248 13:61647221-61647243 AAAAGAGGCTATAAGTATAAAGG - Intergenic
1110721053 13:78762476-78762498 ACCAGATTCTAAGAATATAAAGG + Intergenic
1111697561 13:91643835-91643857 ATGAGATCATATGAGTGTAATGG - Intronic
1113006872 13:105715264-105715286 ATCAGAAGCTATTAATAGAAAGG + Intergenic
1113268719 13:108648814-108648836 TTCAGATTTTCTGAGTATAAGGG - Intronic
1116756676 14:48957501-48957523 ATCAGAGGCTCAGAGTATCAAGG + Intergenic
1117368812 14:55056917-55056939 ATAAGATGCTAAGAATACAAAGG + Intronic
1117408224 14:55425886-55425908 AGCAGATGCTAGGATGATAATGG - Intronic
1119529212 14:75347912-75347934 GTCAGAGGCTTTGACTATAAGGG + Intergenic
1120649384 14:87113219-87113241 ATTAGATGCTAATAGTTTAAAGG - Intergenic
1125620248 15:41054595-41054617 GTCAAATGCTATGGGTCTAATGG - Intronic
1128206793 15:65859779-65859801 ATATAATGCTATAAGTATAAAGG - Intronic
1129298377 15:74612063-74612085 ACCAGCTGCTGTGAGGATAATGG - Intronic
1137532142 16:49284545-49284567 AACACATGCTATGTGGATAAGGG - Intergenic
1139117611 16:63975726-63975748 ATAAAATGCGATGAGTAGAAAGG + Intergenic
1139334658 16:66223367-66223389 ATGAGCTGCTAGGAGTAAAAGGG - Intergenic
1140225043 16:73070368-73070390 CTCAGATGCTATGAGTGTCTTGG - Intergenic
1140270602 16:73463117-73463139 AGCAGAAACTATGAGTATTATGG - Intergenic
1140727822 16:77829870-77829892 CTCAGATGATATGATGATAAAGG - Intronic
1140730722 16:77853496-77853518 ATCAGATACTGTGAGCATCATGG + Intronic
1143495585 17:7310727-7310749 ATAAGATGCTAAGAGTCTAGGGG - Intronic
1148164664 17:45475013-45475035 ATCACATGCTATGGGAAGAAAGG + Intronic
1150395883 17:64821680-64821702 ATCACATGCTATGGGAAGAAAGG + Intergenic
1150514162 17:65790232-65790254 ATCAGAAGCAAAGACTATAAGGG + Intronic
1151066881 17:71161155-71161177 ATCCCATGCTATGAGCATACAGG + Intergenic
1151066893 17:71161229-71161251 ATCCCATGCTATGAGCATAGGGG + Intergenic
1151066954 17:71161548-71161570 ATCCCATGCTATGAGCATATGGG + Intergenic
1151066960 17:71161577-71161599 ATCCCATGCTATGAGCATAGGGG + Intergenic
1151066964 17:71161606-71161628 ATCTCATGCTATGAGCATAGAGG + Intergenic
1151067053 17:71162157-71162179 ATCCCATGCTATGAGCATACGGG + Intergenic
1153545482 18:6200589-6200611 GTCATATGTTATTAGTATAATGG + Intronic
1159882873 18:73876095-73876117 ATCAGATGATATGAGAGAAAAGG - Intergenic
1162489708 19:10984919-10984941 TTCAGATGCTGTATGTATAAGGG - Intronic
1162620595 19:11840482-11840504 CTCAGATTCTCTCAGTATAAAGG - Intergenic
1163882023 19:19932699-19932721 ATAATTTGGTATGAGTATAAAGG - Intronic
1163960586 19:20686814-20686836 AACAATTGGTATGAGTATAAAGG - Intronic
1163971638 19:20802089-20802111 ATAATTTGTTATGAGTATAAAGG - Intronic
1164067413 19:21731138-21731160 ACAAGTTGGTATGAGTATAATGG + Intronic
1164252690 19:23496055-23496077 ATGATTTGCTATTAGTATAAAGG + Intergenic
1168489683 19:56797723-56797745 TTCAGAGGCTGTGAGTTTAAGGG + Intronic
928033124 2:27798213-27798235 TTCAGCTGCTATGAATATAATGG + Intronic
928456492 2:31427407-31427429 ATCAGATGGTGTGAATAAAAAGG - Intergenic
928487134 2:31744070-31744092 ACCAGATGCTTTGGGCATAATGG + Intergenic
931347881 2:61463103-61463125 TTTAGATACTATGAGTATATAGG - Intronic
931659658 2:64547400-64547422 ATGAGATGCAATGAGAATACAGG - Intronic
932833268 2:75010913-75010935 AGCAGATGCAGTGAGAATAAGGG + Intergenic
933432201 2:82197267-82197289 ATCAGATGCTGAGAATATAATGG - Intergenic
934182677 2:89641092-89641114 ATTAAATGCTAAGATTATAATGG - Intergenic
934292970 2:91715283-91715305 ATTAAATGCTAAGATTATAATGG - Intergenic
938665734 2:133534297-133534319 ATTAGATGCAATGAATTTAAAGG - Intronic
939463813 2:142531720-142531742 ATCAGATCCCATAAGTAAAAGGG - Intergenic
939655943 2:144825449-144825471 ATCAGAAGCTATGAGTTTAAGGG + Intergenic
939698473 2:145358381-145358403 ACCAGATGCAATGGGCATAAAGG - Intergenic
942132382 2:172893001-172893023 ATGAGATGCCATAAATATAAGGG - Intronic
942855285 2:180538748-180538770 ATCAGATACTATGACTTTAGGGG - Intergenic
946284292 2:218691450-218691472 GTCATATGCTATGAATAGAATGG + Intronic
947007714 2:225531078-225531100 ATCAGATGAAATGAGCAGAATGG - Intronic
1169863373 20:10174298-10174320 ATCAGGTGCTATTAGTGGAAGGG - Intergenic
1171079940 20:22169829-22169851 ATGAAATGTTATGAGTATGAAGG + Intergenic
1174948416 20:55014654-55014676 TTCAGATGATATGAATAGAATGG - Intergenic
1176729802 21:10482183-10482205 ATTAAATGCTAAGATTATAATGG + Intergenic
1177391618 21:20481457-20481479 AACATATACTATGAGTGTAAAGG - Intergenic
1177825070 21:26073728-26073750 ATCAGATACAATGAGAGTAAAGG + Intronic
1177865440 21:26507539-26507561 ATCAGATGCTATGAGTATAAAGG - Intronic
1178019452 21:28393003-28393025 ACCAGATGCTATTGGTACAAAGG - Intergenic
1179317158 21:40254033-40254055 ATCAGATCCCATGAGTTAAAGGG - Intronic
1179362510 21:40725459-40725481 ATCAGGTGGTATGAGTACAAGGG - Intronic
1183388880 22:37532168-37532190 ATTATCTGCTATGAGTTTAATGG - Intergenic
952924252 3:38309601-38309623 ATCAGATGTTTTGAGTGTAGGGG + Intronic
956505891 3:69939323-69939345 ATGAGATACTATGAGGAAAATGG - Intronic
956590225 3:70906900-70906922 AACAGCTGCTATGGGTATCAAGG - Intergenic
956630110 3:71308469-71308491 ATCAGATACGATGCGTACAATGG + Intronic
957501286 3:81060550-81060572 ATGAGATGCTGAGAGTAAAATGG + Intergenic
958856811 3:99395129-99395151 ATCAGATGCTTTCAGTAAATGGG + Intergenic
960634712 3:119772554-119772576 GTCAGATGATATGATTATACTGG - Intergenic
961842966 3:129733339-129733361 AACAGATGCTATCAGTTCAATGG + Intronic
962044188 3:131738309-131738331 ATCAGATAAGATGTGTATAATGG - Intronic
962356735 3:134700530-134700552 ATCAAATGCTAACAGTATAAGGG - Intronic
970054539 4:11955825-11955847 TTAAGATTCTATGTGTATAAGGG + Intergenic
971053274 4:22885145-22885167 ATCAAATGGTATGAGTAAAATGG + Intergenic
971931304 4:33087131-33087153 ATCAAATGCTATGATTTTTAAGG - Intergenic
972048405 4:34697422-34697444 ATCTGATGCTATGAGAAGATGGG - Intergenic
972129854 4:35819108-35819130 ATCAGATGCTATTGAGATAATGG - Intergenic
976005674 4:80427071-80427093 AACAGATGCTTTGAGGAAAACGG + Intronic
976283083 4:83344595-83344617 TTCAGAATCTATGAGCATAATGG + Intergenic
977211904 4:94227858-94227880 ATCAGATGAAATCAGTGTAAGGG + Intronic
977633128 4:99264759-99264781 AAAGGATGCAATGAGTATAAAGG - Intergenic
977932468 4:102763528-102763550 ATCAGACACTATGAGTCTAAAGG - Intergenic
978370561 4:108025913-108025935 GACAGATGCTATCAGTATATTGG - Intronic
978448848 4:108807102-108807124 ATTAGATGCTGTGTGTATGAGGG + Intergenic
981401571 4:144320103-144320125 ATAAGATGCAATCAGAATAATGG + Intergenic
984846598 4:184113472-184113494 CTCAGGTGTTCTGAGTATAAAGG + Intronic
991360565 5:65815574-65815596 TTCAAATGCTCTGAGTATCATGG + Intronic
993104774 5:83587653-83587675 ATCACATGCTTTGTGTTTAATGG - Intergenic
994981937 5:106886392-106886414 AATAGATGCTATGTGTACAAAGG + Intergenic
997251733 5:132393790-132393812 ACCAGATGCTAAGAGTCAAAGGG + Exonic
998973205 5:147615144-147615166 ACCAGGTGCTGGGAGTATAATGG - Intronic
999792990 5:154959825-154959847 ATCAAATGATAAGAGTACAAAGG - Intronic
1000670351 5:164054593-164054615 TTCAGCTGCTATGAATAGAACGG - Intergenic
1003299139 6:4861153-4861175 ATGTGATGCTATGAGCAAAATGG + Intronic
1003339119 6:5202873-5202895 ATTATATGCTATAATTATAAAGG - Intronic
1010552663 6:77242296-77242318 GTTAGATGCCAAGAGTATAATGG - Intergenic
1010601689 6:77835604-77835626 ATCAGATACTATGATTATGTGGG + Intronic
1011899337 6:92272687-92272709 ATGAAATGCTTTGAGAATAAAGG - Intergenic
1012742625 6:103037724-103037746 AACAGATGCTAAGATTACAAAGG - Intergenic
1013874709 6:114810909-114810931 TCCAGAAGCTAAGAGTATAATGG - Intergenic
1014790975 6:125671798-125671820 AACAGATGCTTTTATTATAAAGG - Intergenic
1015961510 6:138654635-138654657 ATGAGATGCTATTAGTATTCTGG + Intronic
1020485957 7:8721042-8721064 AACAGATGCCATTAGAATAATGG + Intronic
1022166681 7:27772001-27772023 CTCAGATTCTAAAAGTATAATGG + Intronic
1028226040 7:88253953-88253975 ATGAGATTCTCTGAGTTTAATGG + Intergenic
1028901250 7:96102704-96102726 AGCAGATGCTATGATATTAATGG + Intronic
1029201850 7:98844525-98844547 GACATATGCCATGAGTATAAGGG + Intergenic
1030837103 7:114302281-114302303 TTCATATGCTGTGACTATAAAGG - Intronic
1032022291 7:128415094-128415116 ACTAGATGCTGGGAGTATAATGG + Intergenic
1032636011 7:133709978-133710000 ATTTGATGCTAAGAGGATAATGG - Intronic
1033948309 7:146750536-146750558 ATCAGATGCTGTGTGGATACTGG + Intronic
1036642345 8:10592274-10592296 ATAAGATGCAAACAGTATAACGG + Intergenic
1038895689 8:31779224-31779246 ATGAGATGCTATGTGTGCAAAGG + Intronic
1039157831 8:34581702-34581724 ATGAGATGGTAAGAGAATAATGG - Intergenic
1043286335 8:78536373-78536395 ATGAGAGGCTATGAAAATAAAGG + Intronic
1044773175 8:95659076-95659098 CTCAGGTGCTATGAGTATCTGGG - Intergenic
1051652735 9:19345326-19345348 ATGAGGTGCTAGGAATATAAAGG - Intronic
1055539856 9:77291846-77291868 ATCAGATGCCATGAGGAGGAGGG - Intronic
1059979065 9:119749369-119749391 ATCAAAAGTTAGGAGTATAACGG - Intergenic
1060360218 9:122948996-122949018 GTCAAATGCTGGGAGTATAACGG - Intronic
1203584480 Un_KI270746v1:51891-51913 ATTAAATGCTAAGATTATAATGG - Intergenic
1186076629 X:5886775-5886797 ATTAGTTGCTATCAGGATAATGG - Intronic
1187888955 X:23915330-23915352 ATTAGATGCTAGGAATATAGTGG + Intronic
1188794725 X:34448049-34448071 ATTAGATGCTATCAGTTCAAAGG + Intergenic
1195064232 X:101225169-101225191 ATAAGATGCAGTGAGTCTAATGG - Intronic
1195858255 X:109353974-109353996 AACATATCCTCTGAGTATAAGGG + Intergenic
1195865454 X:109427802-109427824 AACAGATGTCATGAGGATAATGG + Intronic
1196574665 X:117304138-117304160 ACCAGATGCTAAAAGCATAAGGG + Intergenic
1198799341 X:140433112-140433134 ATCAAATGAAATGAGTATCATGG - Intergenic
1199779402 X:151044457-151044479 TTCAGATTCTATGGGCATAAAGG + Intergenic
1201565395 Y:15360156-15360178 ATCCCATGCTATTAGTAAAATGG - Intergenic