ID: 1177866507

View in Genome Browser
Species Human (GRCh38)
Location 21:26518967-26518989
Sequence GTTTGCAGTGGATCACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177866507_1177866510 5 Left 1177866507 21:26518967-26518989 CCTGTTTGTGATCCACTGCAAAC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1177866510 21:26518995-26519017 AATATAGTTCCTAAGGTTAGAGG 0: 1
1: 0
2: 1
3: 14
4: 169
1177866507_1177866509 -2 Left 1177866507 21:26518967-26518989 CCTGTTTGTGATCCACTGCAAAC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1177866509 21:26518988-26519010 ACAATTTAATATAGTTCCTAAGG 0: 1
1: 0
2: 0
3: 15
4: 252
1177866507_1177866511 8 Left 1177866507 21:26518967-26518989 CCTGTTTGTGATCCACTGCAAAC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1177866511 21:26518998-26519020 ATAGTTCCTAAGGTTAGAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 247
1177866507_1177866513 15 Left 1177866507 21:26518967-26518989 CCTGTTTGTGATCCACTGCAAAC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1177866513 21:26519005-26519027 CTAAGGTTAGAGGTGGTTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177866507 Original CRISPR GTTTGCAGTGGATCACAAAC AGG (reversed) Intronic
900117820 1:1035985-1036007 CTTTGCAGAGGAACACAGACGGG + Intronic
910610271 1:89133901-89133923 GGCTGCAGTGGAGCACAACCAGG + Intronic
911004515 1:93204648-93204670 GTCTGCAGTTGATTACAAAGTGG + Intronic
912996351 1:114535947-114535969 GTTTGCAGTGTAGCCCAAATCGG + Intergenic
913053525 1:115137399-115137421 GTTTGCTGGGGATCAGAAATTGG - Intergenic
913648217 1:120882649-120882671 GTTTGAAATGGATGATAAACAGG - Intergenic
914078472 1:144380634-144380656 GTTTGAAATGGATCATAAACAGG + Intergenic
914100707 1:144585868-144585890 GTTTGAAATGGATCATAAACAGG - Intergenic
914173382 1:145249182-145249204 GTTTGAAATGGATGATAAACAGG + Intergenic
914298275 1:146351781-146351803 GTTTGAAATGGATGATAAACAGG + Intergenic
914375494 1:147070111-147070133 GTCTGCATTTGACCACAAACTGG - Intergenic
914450023 1:147783038-147783060 TTTTGTAGTAGATTACAAACTGG - Intergenic
914528033 1:148490319-148490341 GTTTGAAATGGATGATAAACAGG + Intergenic
914638354 1:149576748-149576770 GTTTGAAATGGATGATAAACAGG - Intergenic
917721774 1:177792606-177792628 GAATGCAGTGGCACACAAACAGG + Intergenic
918519647 1:185401447-185401469 CTTTGCAGCAGATCACAAAATGG - Intergenic
920281611 1:204847743-204847765 GATGGCAGTGGATCAAACACAGG - Intronic
920438926 1:205965591-205965613 GTGTGCAGTGGACCAAAAAGAGG - Intergenic
923057295 1:230436598-230436620 GTTTGCAGAGACTCACAAAAAGG + Intergenic
923200436 1:231705565-231705587 GTTTGAAATGGATCACAAAAGGG + Intronic
924355666 1:243172822-243172844 GTTTGGAGTAGATGACAATCAGG - Exonic
924887058 1:248229821-248229843 GACTGCAGTGGATCACAGCCAGG - Intergenic
1063862771 10:10329816-10329838 GATTGCAGTAGATCACCAAGAGG - Intergenic
1065508134 10:26450142-26450164 TTTTGCAGTGGATCAAACACGGG + Intronic
1070525711 10:77294240-77294262 GTTTGCAGTGGCTCACCCAATGG + Intronic
1073852115 10:107633466-107633488 GATTGCAGTAGATCACATATTGG - Intergenic
1076475376 10:130748141-130748163 GTTTGCCGGGGATCATCAACAGG - Intergenic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1080135149 11:28845242-28845264 TTTTGCAGTGGATCCTAAAATGG + Intergenic
1080427267 11:32167624-32167646 AATTGCAGTTGAGCACAAACAGG - Intergenic
1082685062 11:56228007-56228029 GTCTGCAGTGAACCACAATCAGG + Intergenic
1084575829 11:69987291-69987313 GTTTCCAGTGGATCACAGAACGG - Intergenic
1087833835 11:102849643-102849665 GTTTTCAGTGGTTCTCCAACAGG + Intergenic
1094783518 12:33819475-33819497 GTTTGCAGTGGAGCACAGCCAGG - Intergenic
1097894632 12:64812323-64812345 GTTTACTGTGGATCAGACACTGG - Intronic
1100594485 12:96060319-96060341 GTTTGCACAGGAACACAGACAGG + Intergenic
1108715353 13:53073126-53073148 GTTTGGAGAGGACCAGAAACAGG + Intergenic
1109214851 13:59578160-59578182 GTATGCAGTGGAATACTAACTGG + Intergenic
1111580244 13:90213318-90213340 CTTTGCTTTAGATCACAAACTGG + Intergenic
1113155639 13:107318263-107318285 TTGTGCAGTTGATAACAAACAGG - Intronic
1114372444 14:22105167-22105189 GTTTCCTGTGGTTCACAAAGAGG - Intergenic
1118646629 14:67846846-67846868 GTCTGCAGTGGAGCACAACCAGG - Intronic
1120392130 14:83922969-83922991 GTTTGCAGTGTGTCAAAAAAAGG + Intergenic
1120413573 14:84191309-84191331 GTTTGCAGTTGGTCAAAATCAGG + Intergenic
1120927788 14:89814919-89814941 GTTGGCAGTGTATTACAAATTGG - Intronic
1121440990 14:93949272-93949294 GTTTCCGCTGGATCAGAAACTGG - Intronic
1121596223 14:95165167-95165189 GTTTGCAGTGTGTAACAACCAGG - Intergenic
1122198516 14:100107785-100107807 GAATGCAGTGGATTTCAAACTGG + Intronic
1125253696 15:37737298-37737320 GCTTGGAGTGGATCACATATAGG - Intergenic
1135054855 16:19222950-19222972 GATTGCAGCAGCTCACAAACAGG - Intronic
1135486349 16:22869005-22869027 CTGTTCAGAGGATCACAAACAGG - Intronic
1138366703 16:56484678-56484700 GTTTGCTTTGGATCACACCCTGG - Exonic
1139452391 16:67040938-67040960 GCTTGCTGTTGATCAAAAACAGG - Intronic
1140779315 16:78279990-78280012 TTTTGCAGAGGATCAGAAAGAGG - Intronic
1141238445 16:82242399-82242421 GGTTGCAGTGGATTATAAAGGGG + Intergenic
1144642437 17:16944983-16945005 GCTTGCTGTGGATTGCAAACAGG - Intronic
1148338824 17:46861101-46861123 GTTGGCAGTGGAACCCCAACTGG + Intronic
1149916481 17:60614064-60614086 CTTTGCAGTGGATCCCGCACCGG - Intronic
1149990475 17:61380461-61380483 CTTTAAAGCGGATCACAAACTGG - Intronic
1154289124 18:13090883-13090905 GTTTGCAGTGGTTCAGAAGCTGG + Intronic
1156058119 18:33035831-33035853 GTTTGGTTTGGATCACAATCTGG + Intronic
1164596534 19:29534004-29534026 GTTTGCAGAGGATATCAACCAGG + Intronic
1166197443 19:41216430-41216452 GGGTGCAGTGGATCACACAGTGG + Intergenic
930371440 2:50506504-50506526 GTTAACAGTGGATGACCAACAGG - Exonic
930698224 2:54432854-54432876 CTTTGCAGGGGATCACCAATGGG + Intergenic
939557481 2:143693327-143693349 GTTTCAAATGGATCACAAACGGG - Intronic
941282342 2:163568687-163568709 GTTAGCAGTGGTTCTCAAAATGG - Intergenic
947281526 2:228460689-228460711 ATTTGCAGTGGAGCACAGTCAGG - Intergenic
947667480 2:231915798-231915820 GTCTTCAGTGAATCAAAAACAGG + Intergenic
1172870909 20:38135016-38135038 GTCTCCAGTGGATCCCCAACAGG + Intronic
1176704051 21:10096897-10096919 GTTTGCATAGGATGACAACCTGG - Intergenic
1177866507 21:26518967-26518989 GTTTGCAGTGGATCACAAACAGG - Intronic
1184553557 22:45219139-45219161 GTGGGCAGTGCATCACAAATGGG - Intronic
952225826 3:31374838-31374860 GTGTCCAGTGGATCTCATACAGG - Intergenic
954245182 3:49325809-49325831 CTTTGCAGTGCTTGACAAACAGG + Exonic
958687324 3:97415673-97415695 GTTTGAAGCAGATCACAAAATGG + Intronic
960734917 3:120768387-120768409 GTTTTCAAAGCATCACAAACCGG - Intronic
973756718 4:54081996-54082018 GTGTGCCATGGACCACAAACAGG + Intronic
976098015 4:81529216-81529238 GTTTGCACTGGTTTGCAAACTGG + Intronic
976577408 4:86690057-86690079 TTTTTCAGTTGATAACAAACAGG + Intronic
978075945 4:104529726-104529748 GTTTGAAGGGGAGAACAAACAGG - Intergenic
979246143 4:118506805-118506827 GTTTGGAGTAGATGACAATCAGG + Intergenic
980376269 4:131953233-131953255 GTTTGCATAGGATGACAACCTGG - Intergenic
981095595 4:140776178-140776200 CTTTGCTGTGGATCTCAAAGAGG - Intergenic
981311902 4:143305680-143305702 GTTTGCAGTTGAGCCCAACCTGG + Intergenic
982172600 4:152676223-152676245 GTTTGCACTGGGTCAGAGACTGG - Intronic
983186134 4:164702848-164702870 ATTTGCAGTTGATCTGAAACTGG - Intergenic
984572956 4:181415313-181415335 GTTTGCTGTGGTTCCCACACTGG + Intergenic
987990990 5:25212527-25212549 GTTTGTAGTGGAACACAGCCAGG + Intergenic
988586274 5:32510270-32510292 GGGAGCAGTGGATCTCAAACTGG + Intergenic
991239736 5:64443914-64443936 GTTTTCTGTGGATGACAAAAAGG - Intergenic
996760766 5:126984005-126984027 GTTAGCTGTAGATCACAAGCAGG - Intronic
997191679 5:131943367-131943389 CTTTGCAGTGGATCACAGGTTGG - Intronic
1003761069 6:9179544-9179566 TTTTGCTGTGTATCACGAACTGG - Intergenic
1004922887 6:20393750-20393772 GTTGGCAGCATATCACAAACAGG - Intergenic
1005362243 6:25041888-25041910 GATTACACTGGATCAGAAACAGG - Intronic
1009355560 6:62740177-62740199 GGCTGCAGTGGAGCACAGACAGG + Intergenic
1013393847 6:109714027-109714049 GTTTGTAGTGGAGCACAGCCAGG - Intronic
1015120667 6:129698139-129698161 GTTTGCAGTGCATCTCAATTGGG - Intronic
1015236128 6:130973331-130973353 GTTTTCATTGGTTCACAAAGGGG + Intronic
1017928338 6:158930042-158930064 GGTGGGTGTGGATCACAAACAGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1022763583 7:33383999-33384021 GTCTGTAATTGATCACAAACTGG - Intronic
1027907270 7:84201149-84201171 TTTTTCAGTGGATAACAAAGGGG - Intronic
1034052985 7:148002928-148002950 GTTTACAGTTGAACACAAAAAGG + Intronic
1036553392 8:9835460-9835482 ATTTGCTGTGAATCGCAAACTGG + Intergenic
1040894100 8:52348063-52348085 GTTTTGAGTGGCTCACGAACTGG + Intronic
1040962713 8:53051897-53051919 GTCTGCAGTGGAGCACAAACAGG - Intergenic
1043917327 8:85938048-85938070 GTATGCAGTGGAGCACAACTGGG + Intergenic
1045577854 8:103445254-103445276 ATTTGCAGTGGAAGACAAAGAGG - Intergenic
1051486863 9:17618103-17618125 GTTTGCATTGGTTCTCAACCGGG + Intronic
1051563810 9:18473298-18473320 GTTGGCAGTGCATCAAAACCAGG + Intergenic
1053764822 9:41381557-41381579 GTTTGCATAGGATGACAACCTGG + Intergenic
1054322058 9:63680213-63680235 GTTTGCATAGGATGACAACCTGG - Intergenic
1056705131 9:88945643-88945665 GTATGCAGTGCATGCCAAACTGG - Intergenic
1057279692 9:93700764-93700786 GTGTGCAGTGGTTTACAAATGGG - Intergenic
1058503292 9:105644746-105644768 GTTTGCTTTGGAGCCCAAACTGG + Intergenic
1058732710 9:107865674-107865696 GTTTGCCGTGAATGACAAAGAGG - Intergenic
1061466007 9:130780306-130780328 TTTTGAAGTGGTTCACAAAATGG - Intronic
1202789088 9_KI270719v1_random:66990-67012 GTTTGCATAGGATGACAACCTGG - Intergenic
1189891852 X:45610884-45610906 GTCTGCAGTGGAGAACAACCAGG - Intergenic
1197076895 X:122363885-122363907 GTTTGTAGTGGAGCACAGCCAGG - Intergenic
1202138835 Y:21699758-21699780 GTTTGCAGTGGATGTAAAGCAGG + Intergenic