ID: 1177874367

View in Genome Browser
Species Human (GRCh38)
Location 21:26612829-26612851
Sequence CATTTTAACCACAAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177874367_1177874372 -1 Left 1177874367 21:26612829-26612851 CCCCCATCCTTGTGGTTAAAATG No data
Right 1177874372 21:26612851-26612873 GCAAGTTAAACTATACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177874367 Original CRISPR CATTTTAACCACAAGGATGG GGG (reversed) Intergenic
No off target data available for this crispr