ID: 1177874372

View in Genome Browser
Species Human (GRCh38)
Location 21:26612851-26612873
Sequence GCAAGTTAAACTATACATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177874368_1177874372 -2 Left 1177874368 21:26612830-26612852 CCCCATCCTTGTGGTTAAAATGC No data
Right 1177874372 21:26612851-26612873 GCAAGTTAAACTATACATTGAGG No data
1177874371_1177874372 -8 Left 1177874371 21:26612836-26612858 CCTTGTGGTTAAAATGCAAGTTA No data
Right 1177874372 21:26612851-26612873 GCAAGTTAAACTATACATTGAGG No data
1177874370_1177874372 -4 Left 1177874370 21:26612832-26612854 CCATCCTTGTGGTTAAAATGCAA No data
Right 1177874372 21:26612851-26612873 GCAAGTTAAACTATACATTGAGG No data
1177874367_1177874372 -1 Left 1177874367 21:26612829-26612851 CCCCCATCCTTGTGGTTAAAATG No data
Right 1177874372 21:26612851-26612873 GCAAGTTAAACTATACATTGAGG No data
1177874369_1177874372 -3 Left 1177874369 21:26612831-26612853 CCCATCCTTGTGGTTAAAATGCA No data
Right 1177874372 21:26612851-26612873 GCAAGTTAAACTATACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177874372 Original CRISPR GCAAGTTAAACTATACATTG AGG Intergenic
No off target data available for this crispr