ID: 1177878148

View in Genome Browser
Species Human (GRCh38)
Location 21:26659978-26660000
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 4, 1: 22, 2: 84, 3: 212, 4: 547}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177878148_1177878150 -5 Left 1177878148 21:26659978-26660000 CCTGGTCATGAGACAAGAACTTG 0: 4
1: 22
2: 84
3: 212
4: 547
Right 1177878150 21:26659996-26660018 ACTTGGACCTAGCTGAGCTAAGG 0: 9
1: 17
2: 40
3: 45
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177878148 Original CRISPR CAAGTTCTTGTCTCATGACC AGG (reversed) Intergenic
900918208 1:5652961-5652983 CAAGTTCTTCATTCATGGCCAGG - Intergenic
901110304 1:6788085-6788107 CAAGTTCTTTTCTCTTGGACAGG + Intronic
901481402 1:9527745-9527767 CAGGTTCTTGTCACACGACCAGG + Intergenic
901550106 1:9989733-9989755 CAAGTTCTTGTCCAGTGTCCAGG - Intergenic
901957759 1:12798689-12798711 CAAGTTCTTGTTCTGTGACCAGG - Intergenic
901965761 1:12864441-12864463 CAAGTTTTTGTCCTGTGACCAGG - Intronic
901981161 1:13034818-13034840 CAAGTTTTTGTCCTGTGACCAGG - Intronic
902000925 1:13194111-13194133 CAAGTTTTTGTCCTGTGACCAGG + Intergenic
902020155 1:13339815-13339837 CAAGTTTTTGTCCTGTGACCAGG + Intergenic
902644711 1:17790377-17790399 CAAGTTCTTGTCCCATGCCCTGG + Intronic
903513731 1:23895808-23895830 TAAGTCCTTGTGTCATGACAAGG + Intronic
904577368 1:31513665-31513687 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
905546158 1:38801992-38802014 CGAGTTCTTGTCCTGTGACCAGG - Intergenic
906410231 1:45573153-45573175 CAGGTTCTTGTCACATGAACAGG + Intergenic
906913592 1:49983079-49983101 CAAGTTCTTGTCCCATGTCCAGG - Intronic
907123927 1:52032915-52032937 CCAGTACTTGACTCGTGACCTGG + Exonic
908208361 1:61874027-61874049 TGGGTTCTTGTCTCATGATCAGG - Intronic
908574268 1:65442285-65442307 TAAGTTATTGTCTAAAGACCTGG - Intronic
909282369 1:73771268-73771290 CAAGTTCTTGTCCTGCGACCAGG - Intergenic
909388682 1:75092031-75092053 CAGGTTCTTTTCTTACGACCAGG + Intergenic
909771618 1:79430390-79430412 CAGGTTCTTTTCACACGACCAGG + Intergenic
909837622 1:80276703-80276725 CAGGTTCTTGTCTGGTGCCCAGG - Intergenic
909963624 1:81880446-81880468 CAGGTTCTTGTCTCAGTACCAGG + Intronic
910069970 1:83201058-83201080 TGGGTTATTGTCTCATGACCAGG - Intergenic
910101407 1:83582406-83582428 CAAGTTCTTGTCCCACATCCAGG + Intergenic
910189991 1:84585386-84585408 TGGGTTCTTGTCCCATGACCAGG + Intergenic
911162112 1:94691714-94691736 TGAGTTCTTGTCTCACAACCAGG + Intergenic
911231151 1:95362944-95362966 CAAGTTCCGGTCTCAGGGCCCGG - Intergenic
911299762 1:96157631-96157653 CAGGTTCTTGTCACATGACCAGG + Intergenic
911435036 1:97845599-97845621 TGAGTTCTTGTCCCATGTCCAGG - Intronic
911734854 1:101325872-101325894 CAGGTTCTTGTCACACGACCAGG + Intergenic
911805010 1:102194789-102194811 TGGGTTCTTGTCTCATGACCAGG - Intergenic
911997788 1:104788590-104788612 CAAGTTCTTGTCCCACATCCAGG + Intergenic
912044533 1:105437611-105437633 CAAGCTCTTGTCCCATGTCCAGG - Intergenic
912082379 1:105952403-105952425 CAAATTCTTCTCCCATGATCTGG + Intergenic
912094516 1:106121583-106121605 CAAGTTCTTGTCCCACGTCCAGG - Intergenic
912132594 1:106620378-106620400 CAAGTTCTTGTCCTGCGACCAGG - Intergenic
912943008 1:114061450-114061472 CAAGTTCTTGTCTTGAGTCCAGG - Intergenic
913030362 1:114896816-114896838 TAGGTTCTTGTCACATGACCAGG + Intronic
913097694 1:115534946-115534968 CAAGCTCTTGTCTGGTGTCCAGG - Intergenic
913599968 1:120413700-120413722 CAAGTATTTGACTTATGACCTGG - Intergenic
914087090 1:144462963-144462985 CAAGTATTTGACTTATGACCTGG + Intergenic
914311518 1:146471239-146471261 CAAGTATTTGACTTATGACCTGG - Intergenic
916254341 1:162771264-162771286 CAAGTTCTTTTCTACTGACTCGG - Intronic
916638772 1:166703346-166703368 CAGGTTCTTGTCACATGACCAGG - Intergenic
917098255 1:171421619-171421641 CAGGTTCTTGTCACATGACCAGG + Intergenic
917185816 1:172354220-172354242 TGAGTTCTTGTCTCTTGACCAGG + Intronic
918820681 1:189250371-189250393 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
919168742 1:193927724-193927746 CCAGTTCTTGTCCCACGTCCAGG + Intergenic
919262688 1:195218350-195218372 CCAGTTCTTGTCCCATATCCAGG - Intergenic
919264058 1:195238164-195238186 CAAGTTCTTGTCCCACATCCAGG - Intergenic
919302810 1:195791495-195791517 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
921736576 1:218634620-218634642 TGGGTTCTTGTCTCATGACCAGG - Intergenic
921802876 1:219421347-219421369 CATGTTGTTCTCTCATGATCTGG - Intergenic
921901773 1:220458396-220458418 TGGGTTCTTGTCACATGACCAGG - Intergenic
922041628 1:221903496-221903518 CAGATTCTTGTCTTATGACCAGG + Intergenic
922141627 1:222893866-222893888 TAAGTTCTTGTCCCGTGTCCAGG + Intronic
922367631 1:224880864-224880886 TGGGTTCTTGTCACATGACCAGG - Intergenic
923245851 1:232131285-232131307 TGGGTTCTTGTCTCATGGCCAGG - Intergenic
923412620 1:233725230-233725252 CAGGTTCTTGTCACACGACCAGG + Intergenic
923414244 1:233739248-233739270 CAGGCTCTTGTCACACGACCAGG - Intergenic
923900482 1:238320746-238320768 CAGGTTCTTGTCTCACAACCAGG - Intergenic
923917908 1:238529846-238529868 CAAGTTCTTGTCCCATGTCTAGG + Intergenic
924852423 1:247843768-247843790 TAAGTTATTGTCTGAAGACCTGG - Intergenic
1062839017 10:655313-655335 CGGGTTCTTGTCTCACAACCAGG - Intronic
1063306725 10:4909516-4909538 CCGGTTCTTGTGTCATGACCAGG - Intergenic
1064257762 10:13758757-13758779 CAGCTTCTTGTCTCACGACCAGG - Intronic
1064512698 10:16112648-16112670 CTGGTTCTTGTCTTATGTCCTGG - Intergenic
1064598914 10:16973588-16973610 CACGTTCTTTGCTCATTACCTGG - Intronic
1064599744 10:16981417-16981439 CAAGTTCTTGTCCAGTGTCCAGG - Intronic
1064818435 10:19294327-19294349 CAAGTTCTTGCCTCACTACAGGG - Intronic
1065774755 10:29109151-29109173 CGAGGTCATGCCTCATGACCTGG - Intergenic
1065838978 10:29684511-29684533 TAAGTTATTGTCTAAAGACCTGG + Intronic
1066049740 10:31622146-31622168 CGAGTTCTTGTCTGACGACCAGG - Intergenic
1066188925 10:33037526-33037548 CAAGCTCTTGTCTCAGGTCCAGG - Intergenic
1066196313 10:33103849-33103871 GGGGTTCTTGTCTCACGACCAGG + Intergenic
1066241427 10:33539476-33539498 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1066508275 10:36067104-36067126 CGAGTTCTTGTCTCATGTCCAGG - Intergenic
1067258657 10:44666946-44666968 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1067286298 10:44909933-44909955 CAAGGTCTTGTCTGTTGCCCAGG - Intergenic
1068083645 10:52348075-52348097 CAAGATCTTGTCCTATGACCAGG - Intergenic
1068188563 10:53619626-53619648 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1068222531 10:54062619-54062641 CAAGTTATTGCCTAAAGACCAGG + Intronic
1068300411 10:55131529-55131551 TGAGTTTTTGTCTCATGTCCAGG + Intronic
1068443949 10:57095946-57095968 CAAGTTCTTGTCCCTCGTCCAGG - Intergenic
1068474485 10:57507572-57507594 CAAGTTCTTGTCCCATATCCAGG - Intergenic
1068906908 10:62336830-62336852 TGGGTTCTCGTCTCATGACCAGG - Intergenic
1068919295 10:62465745-62465767 CAAGTTCTTGTCCCACATCCAGG - Intronic
1069156324 10:65035066-65035088 TGAGTTTTTGTCCCATGACCAGG - Intergenic
1069329995 10:67280425-67280447 CAGGTTCTTGTCTCACAACCAGG + Intronic
1069575942 10:69528590-69528612 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
1069634239 10:69915741-69915763 CCAGTTCTTGTCTGGTGCCCTGG - Intronic
1070406264 10:76100234-76100256 CAGGTTCTTGTCACATGATCAGG + Intronic
1070859303 10:79637980-79638002 CAAGTTCTTGTCTTACCTCCAGG + Intergenic
1071156215 10:82692441-82692463 TGGGTTCTTGTCTCAAGACCAGG + Intronic
1071960399 10:90804294-90804316 CAGGTTCTTGTCTGGTGTCCAGG - Intronic
1071973996 10:90936907-90936929 CAAGTACCTGCCTCATGGCCAGG + Intergenic
1072335487 10:94394797-94394819 CAAGTTCTTGTCTTGTGTGCAGG + Intergenic
1072408051 10:95173136-95173158 ACAGTTCCTGTCCCATGACCAGG - Intergenic
1073193976 10:101672980-101673002 CAAGTACTCGGCTCATGAACAGG - Exonic
1073558130 10:104473232-104473254 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1073664057 10:105510065-105510087 CGGGTTCTTGTCACATGACTAGG + Intergenic
1073680284 10:105695986-105696008 CAAGTTCTTTTATCATGGCAGGG + Intergenic
1073845135 10:107545530-107545552 CAAGTTCTTGTCCCACATCCAGG - Intergenic
1073903554 10:108250663-108250685 TGGGTTCTTGTGTCATGACCAGG - Intergenic
1074009865 10:109467250-109467272 CAGGCTCTTGTCTCATGACCAGG - Intergenic
1074028849 10:109664331-109664353 CAAGTCCTTGTCCTGTGACCAGG - Intergenic
1074738875 10:116464979-116465001 CAGGTTCTTGTCCCACGTCCAGG + Intronic
1074979586 10:118608844-118608866 TAAGTTCTTGTCCCATGTCCAGG + Intergenic
1075007898 10:118843590-118843612 CAAGTTCTTGCCCTGTGACCAGG - Intergenic
1075875302 10:125800939-125800961 TGGGTTCTTGTCTCATGACCAGG - Intronic
1076074036 10:127518346-127518368 TAATTTCTTGTCTTATGTCCCGG - Intergenic
1077576039 11:3384196-3384218 ACAGTTCCTGTCCCATGACCAGG + Intergenic
1078315102 11:10288256-10288278 CAAGTTCTTGTTCTGTGACCAGG + Intronic
1078900682 11:15639640-15639662 CAGGTGCTTCTCTCCTGACCTGG - Intergenic
1079538061 11:21539415-21539437 CAAGCTCTTGTCTGGTGTCCAGG + Intronic
1079674086 11:23203020-23203042 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1080074564 11:28134150-28134172 CATGTTCTTGTCTCATGACCAGG + Intronic
1080075276 11:28140606-28140628 TAGGTTCTTGTCTCATGACCAGG + Intronic
1080485766 11:32704964-32704986 TGAGTTCTTGTCCCATGTCCAGG - Intronic
1080706742 11:34702110-34702132 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
1080966945 11:37224384-37224406 TGAGTTCTTGTCCCATGTCCAGG + Intergenic
1081001818 11:37682764-37682786 CAAGTTCTTGTCTAGAGTCCAGG + Intergenic
1081010941 11:37811946-37811968 CAAGTTCTTGTATGGTGTCCAGG + Intergenic
1081069661 11:38595393-38595415 CAGGTTCTCATCTCAAGACCAGG - Intergenic
1081100581 11:38997043-38997065 CAGGTTCTTGTTACAAGACCAGG + Intergenic
1081131135 11:39381604-39381626 CAAGCTCTTGTCTGGTGTCCAGG + Intergenic
1081334077 11:41842665-41842687 CAAGCTCTTGTCTAGTGCCCAGG - Intergenic
1082036827 11:47651778-47651800 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1082687654 11:56260044-56260066 CAAGTTCTTGTCCCACATCCAGG + Intergenic
1082701176 11:56433124-56433146 CAAGCTCTTGTCCTATGTCCAGG + Intergenic
1082942653 11:58724578-58724600 CAAGTTCTTTATTAATGACCAGG + Intronic
1082944117 11:58740182-58740204 CAGGTTCTTGTCTCATGACTAGG - Intergenic
1083916147 11:65744882-65744904 TAAGTTCTTGTCGTGTGACCAGG - Intergenic
1084991197 11:72926702-72926724 CAAGTTCTTGTCCTGTGTCCTGG - Intronic
1085987547 11:81805231-81805253 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1086092834 11:83021200-83021222 CAAGTTCTTGTCCTATGACCAGG - Intronic
1086133632 11:83425097-83425119 GGGGTTCTTGTCACATGACCAGG + Intergenic
1086458901 11:86986020-86986042 CAGGTTCTTGTCACACGACCAGG - Intergenic
1087120023 11:94564046-94564068 CGAGTTCTTGTCACATGACCAGG + Intronic
1087470058 11:98561714-98561736 TGGGTTCTTGTCTCATGAACAGG - Intergenic
1088100719 11:106152537-106152559 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1088559340 11:111097125-111097147 CGGGCTCTTGTCACATGACCAGG + Intergenic
1088651819 11:111964231-111964253 CAAGTTTTTCTCTGTTGACCAGG - Intronic
1088748566 11:112824680-112824702 CAGGTTCTTGTCTCGTGTCCAGG - Intergenic
1089173023 11:116528369-116528391 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1089561850 11:119347106-119347128 CATGTTCTTCTCTCTTGTCCTGG - Intergenic
1090728697 11:129551229-129551251 TGAGTTCTTGTCTCATGACCAGG - Intergenic
1090873400 11:130767664-130767686 CAGGTTGTTGTCTCACGACCGGG - Intergenic
1090910083 11:131111096-131111118 TAAGTTTTTGTCCCATGTCCAGG + Intergenic
1091019039 11:132082209-132082231 CCAGTTCTTGTTTCATGACCAGG + Intronic
1092013819 12:5139925-5139947 TAGGTTTTTGTCTCATGAACAGG + Intergenic
1092061898 12:5557896-5557918 CGGGTTCTTGTCACATGCCCGGG + Intronic
1092234267 12:6796401-6796423 CAAGATCTTGTCTCACCAGCAGG + Intronic
1092585512 12:9897469-9897491 CAGGTTCTTGTCACACGACCAGG + Intergenic
1092698655 12:11202240-11202262 CAAGTTCTTGTCTCACAACCAGG - Intergenic
1092931151 12:13317077-13317099 CAAGTTCTTGTCCCACAACAAGG - Intergenic
1093298048 12:17416324-17416346 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
1093331682 12:17851083-17851105 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1093705775 12:22273539-22273561 TGGGTTCTTGTCTCATGACCAGG - Intronic
1093754783 12:22840404-22840426 CAATTTCTTCTCTAATGACTGGG + Intergenic
1094003218 12:25718748-25718770 CAGTTTCTTGTCACATGACCAGG - Intergenic
1094315348 12:29133470-29133492 TGGGTTCTTTTCTCATGACCAGG + Intergenic
1094317018 12:29146150-29146172 TGTGTTCTTGTCTCATAACCAGG + Intergenic
1094440484 12:30470582-30470604 TGGGTTCTTGTCCCATGACCAGG + Intergenic
1094443666 12:30506780-30506802 CAGGTTCTTGTCACACGACCAGG - Intergenic
1094638351 12:32248707-32248729 CAGGTTCTTGTCTCACAACCAGG + Intronic
1094716658 12:33020848-33020870 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1095247430 12:39939230-39939252 CAAGTCCTTGTCTTAGGGCCTGG + Intronic
1095968439 12:47884754-47884776 CAGGTTCTTCCCTCATGACCTGG - Intronic
1096294986 12:50376274-50376296 CAAGTTCCTGTCTCATGTCTAGG + Intronic
1096355472 12:50937627-50937649 CAAGTTCTTGTTCCGTGTCCTGG + Intergenic
1096602936 12:52743016-52743038 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1096716927 12:53497201-53497223 AAAGTTCTTGGCCCAGGACCTGG + Intronic
1096928213 12:55173100-55173122 CACGTTCTTGCCTCACAACCAGG - Intergenic
1097360743 12:58655850-58655872 TAAGTTCTTGTCCCATGTCCAGG + Intronic
1097419614 12:59358214-59358236 CAGGTTCTTTTCTCACAACCAGG - Intergenic
1097747837 12:63318733-63318755 CAAATTCTTGTCCAGTGACCAGG + Intergenic
1098951653 12:76645757-76645779 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1099295459 12:80823159-80823181 CAAGTTCTTGTCCTATGTCCAGG - Intronic
1099529052 12:83752950-83752972 CAGGTTCTTGTCACACGACCAGG - Intergenic
1100233517 12:92634188-92634210 CGGGTTCTTGTCACATGACCAGG + Intergenic
1100263442 12:92953990-92954012 TGGGTTCTTGTCTCACGACCAGG + Intergenic
1100766773 12:97875016-97875038 CAGGTTCTTGTGTCACTACCAGG + Intergenic
1100847966 12:98679479-98679501 CAAGTTCTTGTCCTACAACCAGG - Intronic
1101775366 12:107788652-107788674 CGAGTTCTTGTGTCACGACCAGG + Intergenic
1104144199 12:126017265-126017287 CAAGTTCTTGTCTCACGACCAGG - Intergenic
1104742649 12:131189683-131189705 CAAGGTCTTTTCCCATGTCCAGG - Intergenic
1105266690 13:18825115-18825137 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1106379609 13:29223635-29223657 CAAGTTCTTGTCCCATGTCCAGG - Intronic
1106943834 13:34803544-34803566 CAAGTTCTTGTCACACAACTGGG + Intergenic
1106979036 13:35255842-35255864 CAAGTTCTTGACCCATGTTCAGG + Intronic
1107147113 13:37070783-37070805 CAAGTTCTTGTCTTGTGACCAGG - Intergenic
1108088344 13:46818876-46818898 CAAGTTCTTGTCCTACGTCCTGG - Intergenic
1108160221 13:47631603-47631625 CAGGTTCTTATCTCACAACCAGG + Intergenic
1108249655 13:48551569-48551591 CGAGTTGTTGTCCCATGTCCAGG - Intergenic
1108871140 13:54987962-54987984 CAGATTTTTGTCACATGACCAGG + Intergenic
1108940444 13:55946993-55947015 CTGGTTCTTGTCCCATGACCAGG - Intergenic
1109396440 13:61765885-61765907 CAAGTTCTTGTCCCGCGTCCGGG + Intergenic
1109420557 13:62106026-62106048 TAAGTTCTTGTCACATGTTCAGG - Intergenic
1109470707 13:62799979-62800001 CAAGTTCTTGTCCCATGCCCAGG - Intergenic
1109562795 13:64075496-64075518 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1109603635 13:64663571-64663593 CAAGTTCTTGTCCCACATCCAGG - Intergenic
1109638909 13:65161232-65161254 CAGGTTCTCGTCTCATGACCTGG + Intergenic
1109831158 13:67790945-67790967 CAAGTTTTTGTCTCATGACCCGG + Intergenic
1109892148 13:68629885-68629907 CAAGTTCTTGTTTCATGACCAGG + Intergenic
1109924043 13:69110298-69110320 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1110014693 13:70386414-70386436 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1110047194 13:70845063-70845085 CAAGTTCTTATCTCACATCCAGG + Intergenic
1110439082 13:75507662-75507684 CAAGTTCTTTTCCCAAGTCCAGG + Intergenic
1110935624 13:81284223-81284245 CAAGTTCATGTCTCACAACAAGG - Intergenic
1111182537 13:84687509-84687531 CAAGATCTTGTCTAATATCCAGG + Intergenic
1111227352 13:85291049-85291071 CAGGTTCATGGCTCATGGCCGGG - Intergenic
1111268887 13:85854150-85854172 CCAGTTCTTGTCCCATGTCCAGG - Intergenic
1111294399 13:86260134-86260156 CAAGTTCTTGATTTTTGACCTGG - Intergenic
1111485753 13:88896301-88896323 AGAGTTCTTGTCCCATAACCAGG - Intergenic
1111595446 13:90404565-90404587 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
1112086180 13:96034448-96034470 CAAGTTCTTGTTGCATGTTCAGG - Intronic
1112261490 13:97881936-97881958 CAGGTTCTTGTCTGGTGTCCAGG + Intergenic
1112343785 13:98574324-98574346 CTTTTTCTTGTCTCCTGACCAGG - Intronic
1112556307 13:100471933-100471955 CAGGTTCTTGTCTCAGGACTGGG + Intronic
1113289216 13:108886413-108886435 CAGGTTCTTGCCTCACGACCTGG + Intronic
1114281109 14:21193002-21193024 CGAGTTCTTGTCCTGTGACCAGG - Intergenic
1114980464 14:28157869-28157891 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1115898449 14:38117797-38117819 CTGGTTCTTGTCTCATGACCAGG - Intergenic
1116102833 14:40464301-40464323 CGGGTTCTTGTCTTATGACCAGG - Intergenic
1116103520 14:40470522-40470544 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1116118671 14:40693883-40693905 TGAGTTCTTGTCCCATCACCAGG + Intergenic
1116159706 14:41253279-41253301 TGAGTTCTTGTCTCATGTCCAGG + Intergenic
1116256384 14:42562013-42562035 CGGGTTCTTGTCACATGTCCAGG + Intergenic
1116313709 14:43359880-43359902 CAAGTTCTTGTCATGTGTCCAGG + Intergenic
1116369258 14:44109040-44109062 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1116679577 14:47948969-47948991 CAGGTTCTTATCACACGACCAGG + Intergenic
1117385898 14:55212554-55212576 CGAGTTATTGTCTCATGACCAGG + Intergenic
1117413110 14:55468411-55468433 TGAGTTCTTGTCCCATGTCCAGG + Intergenic
1117440667 14:55756258-55756280 GAAGTGCTTGTCTCATGCCTGGG + Intergenic
1117648397 14:57877105-57877127 CAGGTACTAGGCTCATGACCTGG - Intronic
1117991625 14:61439570-61439592 CAATGTCTTCTCTCACGACCTGG - Intronic
1118486932 14:66223335-66223357 TGGGTTCTTGTCACATGACCAGG + Intergenic
1118999051 14:70864986-70865008 CAGGTTCTTGTCTCACAACCAGG + Intergenic
1118999904 14:70872426-70872448 AGAGTTCTTGTCTCATGACCAGG + Intergenic
1119588827 14:75865417-75865439 CAGGTCCTTGGCTCATTACCTGG + Intronic
1120811550 14:88808724-88808746 CAGATTCTTGTCACATAACCAGG + Intergenic
1121368652 14:93337357-93337379 CGAGTTCTTGTCCCATGTCAAGG - Intronic
1122641485 14:103162325-103162347 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1123406334 15:20021288-20021310 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1123515664 15:21027936-21027958 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1123765133 15:23470738-23470760 CAAGTTCTTGTCTGGAGTCCAGG + Intergenic
1123777622 15:23596629-23596651 CAGGTTCTTGTCACATAACCAGG + Intronic
1123888096 15:24748010-24748032 CAGGTTCTTGTCCCACGACCAGG + Intergenic
1124937645 15:34187408-34187430 CAAGTTCTTGTCCTGTGTCCAGG - Intronic
1125114006 15:36067391-36067413 CGAGTTCTTGTCTCACATCCAGG + Intergenic
1125241608 15:37582743-37582765 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1125752427 15:42037559-42037581 CAAGTTCTTGTCCTGTGACCAGG - Intronic
1126156823 15:45573796-45573818 CAAGTTCTTGTCCTATGTCCAGG + Intergenic
1126212117 15:46111579-46111601 CAAGTTCTTGTCTGGCGCCCAGG - Intergenic
1126666184 15:51077956-51077978 GGGGTTCTTGTCACATGACCAGG - Intronic
1126990796 15:54373817-54373839 CAAGTTCTTGTCTCACATCCAGG + Intronic
1127016590 15:54695482-54695504 CAGGTTCTTGTCATATGACCAGG - Intergenic
1127695699 15:61444649-61444671 TGAGTTCTTGTCTCACAACCAGG + Intergenic
1128732018 15:70027501-70027523 GAGGTTCTTTTCTCATAACCAGG + Intergenic
1129925852 15:79364020-79364042 CAGGTTCTTGTCTCACAACCAGG + Intronic
1133843923 16:9436801-9436823 TGAGTTCTTGTCTCATGACCAGG - Intergenic
1135124346 16:19795604-19795626 CAAGTTCTTGATTTTTGACCTGG + Intronic
1135313644 16:21425047-21425069 ACAGTTCCTGTCCCATGACCAGG - Intronic
1135366568 16:21857327-21857349 ACAGTTCCTGTCCCATGACCAGG - Exonic
1135445247 16:22513831-22513853 ACAGTTCCTGTCCCATGACCAGG + Exonic
1136193964 16:28638390-28638412 ACAGTTCCTGTCCCATGACCAGG + Exonic
1136310306 16:29403751-29403773 ACAGTTCCTGTCCCATGACCAGG - Exonic
1136323755 16:29505541-29505563 ACAGTTCCTGTCCCATGACCAGG - Exonic
1136438440 16:30245522-30245544 ACAGTTCCTGTCCCATGACCAGG - Exonic
1137588710 16:49680368-49680390 CAAGTTCTTGTCCCATGTCCAGG - Intronic
1137976127 16:53033624-53033646 CAAGTTCTTGTCTCACATCCAGG - Intergenic
1138978777 16:62241246-62241268 CAGGTTCTTGTCTCATAACCAGG - Intergenic
1139857989 16:69996137-69996159 ACAGTTCCTGTCCCATGACCAGG - Intergenic
1140792812 16:78408508-78408530 CAACTGCTTGTCTCACAACCAGG - Intronic
1141433502 16:83983714-83983736 AAAATTCTTGGCTCATGACAAGG - Intronic
1142477163 17:195378-195400 CAACTTCCTGTTTCATGACTTGG - Intergenic
1143156865 17:4843017-4843039 CAAGTTCTGCTCTCTTGACTGGG - Intronic
1143533691 17:7522863-7522885 CAGGTTCTTATCACACGACCAGG + Intergenic
1144060875 17:11582651-11582673 TGAGTTCTTGTCCTATGACCAGG + Intergenic
1144143760 17:12377076-12377098 CAGGCTCTTGTCACATGGCCAGG + Intergenic
1144228556 17:13175643-13175665 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1144334057 17:14253304-14253326 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1144714562 17:17424919-17424941 CAAGTTCTTGTCCCACATCCAGG - Intergenic
1145789025 17:27613328-27613350 CAGGTTCTTGTCTCATGACCAGG + Intronic
1145824978 17:27870044-27870066 TGGGTTCTTGTCTCATGACCAGG - Intronic
1146102975 17:30003937-30003959 CAAGTTCTTGTCTCACAACTAGG + Intronic
1146574450 17:33979093-33979115 CAAGTCTATGACTCATGACCAGG + Intronic
1147515546 17:41114373-41114395 CAAGCTCTTGTCTTGTGTCCAGG - Intergenic
1147569519 17:41560061-41560083 CAGGTTCTTGTCTGGTGTCCAGG - Intergenic
1149034083 17:52115288-52115310 CTAGGTCTTGTCTCAAGACCAGG - Intronic
1149056829 17:52376530-52376552 CAGGTTCTTGTGTCATGACCAGG - Intergenic
1149102313 17:52921804-52921826 CAGGTTCTTGTCACACAACCAGG + Intergenic
1149169505 17:53792522-53792544 CGAGTTCCTGTCCCATGTCCAGG - Intergenic
1149362429 17:55910104-55910126 GAAGTTCTTGTCCTGTGACCAGG + Intergenic
1149762205 17:59242655-59242677 CAGGTTCTTGTCACATGACCAGG + Intronic
1150521106 17:65866910-65866932 CAAGTTCTTGTCCTGTGTCCAGG - Intronic
1150726907 17:67658589-67658611 CGAGTTCTTGTCTCACAACCAGG - Intronic
1151922457 17:77167678-77167700 TGGGTTCTTGTCTCATGACCAGG + Intronic
1153246103 18:3073943-3073965 CAGGTTCTTGTCTCACAACCAGG - Intronic
1153577033 18:6532564-6532586 TGGGTTCTTGTCTCATAACCAGG - Intronic
1153704609 18:7732997-7733019 TGGGTTTTTGTCTCATGACCAGG + Intronic
1153736881 18:8080335-8080357 CATGTGTTAGTCTCATGACCAGG - Intronic
1154119438 18:11639410-11639432 ACAGTTCCTGTCCCATGACCAGG - Intergenic
1154206193 18:12339036-12339058 GATGGTCTTGTCTCCTGACCTGG - Intronic
1154421725 18:14236356-14236378 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1155736967 18:29235939-29235961 GGAGTTCTTGTCTCACAACCAGG - Intergenic
1155802820 18:30130900-30130922 TGAGTTCATGTCCCATGACCAGG - Intergenic
1156185709 18:34660735-34660757 TAAGTTATTGTCTAAAGACCTGG - Intronic
1156993724 18:43440623-43440645 CAAGTTCTTGTCTCACAACCAGG - Intergenic
1157159432 18:45299824-45299846 CCATTTCTTGTCTCAAGTCCTGG + Intronic
1157777807 18:50409973-50409995 TTAGTTCTTGTCACATGACCAGG + Intergenic
1158335017 18:56406707-56406729 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1158639207 18:59189011-59189033 CAGGTTCTTATCTCACGACCAGG + Intergenic
1158968202 18:62642309-62642331 CAAGTCCTGGTCACAGGACCAGG + Intergenic
1159308616 18:66678798-66678820 CAGGTACTTGTCTCATGACCAGG + Intergenic
1159309204 18:66686544-66686566 CAGGTTCTTATCTCACGACCAGG - Intergenic
1159431213 18:68356254-68356276 CAAGCTCTCGTCTCATGTCCAGG - Intergenic
1159539348 18:69755799-69755821 CAGGTTCTTGTCTCACAACCAGG + Intronic
1159623907 18:70669932-70669954 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1159929715 18:74297994-74298016 CATGTTCCTGTCTCATTAACAGG - Intergenic
1160682016 19:416234-416256 CCAGCTCTTGTCTGATGTCCTGG + Intergenic
1163217680 19:15892980-15893002 CAGGGTCATGTCTCATGTCCAGG - Intronic
1163227724 19:15976589-15976611 AAGGTTCTTGTCTCATGCCAGGG + Intergenic
1164810822 19:31154501-31154523 CAGGTTCCTGTCACATGACCAGG + Intergenic
1164984483 19:32638450-32638472 CGAGTTCTTGTCCCATGTCGAGG - Intronic
1166897536 19:46033287-46033309 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1167013232 19:46822491-46822513 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1167327059 19:48833142-48833164 CTAGCTCTTGTCCCCTGACCTGG - Intronic
1167758555 19:51428442-51428464 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1168630154 19:57950086-57950108 CAAGTTCTTATCCCACGTCCAGG + Intergenic
925048249 2:790556-790578 CAAATTCTTGTCCTGTGACCAGG - Intergenic
926239182 2:11071644-11071666 CAGGTTCTTGTCACATGACCAGG - Intergenic
926888925 2:17622669-17622691 CAGGCTCTTGTCATATGACCAGG + Intronic
927072977 2:19549004-19549026 CAAGTTATTGTCTGGTGTCCAGG - Intergenic
927236422 2:20879756-20879778 CAAGTTCTTGTCCCACATCCAGG + Intergenic
928182644 2:29080394-29080416 TGAGTTCTTGTCCCATGTCCAGG + Intergenic
928276850 2:29909130-29909152 CTAGTTCTTGTATCATGGCCAGG - Intronic
928834186 2:35523123-35523145 CAGGTTCTTGTCTAACGACCAGG + Intergenic
929237989 2:39626650-39626672 CGGGTTCTTGTGTCACGACCAGG + Intergenic
929652143 2:43691185-43691207 TGGGTTCTTGTCTCACGACCAGG + Intronic
930946588 2:57083894-57083916 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
931057292 2:58487039-58487061 TGGATTCTTGTCTCATGACCAGG + Intergenic
931471009 2:62537582-62537604 CAGGTTCTTGTAACACGACCAGG - Intergenic
933042643 2:77487976-77487998 CAAGTTCTTGTCGCAAGTCCAGG - Intronic
933056664 2:77679324-77679346 CAGATTCTTGTCTCACAACCAGG + Intergenic
933310264 2:80652028-80652050 CAGGTTCTTGTCACACGACCAGG + Intergenic
933333604 2:80926158-80926180 TAGGTTCTTGTCTAATGACCAGG + Intergenic
933442735 2:82334151-82334173 CAAGCTCTTGTCCTATGTCCAGG + Intergenic
933454964 2:82508484-82508506 CAAGTTCTTGTCCTACGTCCAGG - Intergenic
933534854 2:83558560-83558582 CAGGTTCTTGTCTCATGTCCAGG - Intergenic
933606474 2:84389530-84389552 CTAGTTCTTGTCCCATATCCAGG + Intergenic
933926796 2:87100466-87100488 CAGATTCTTGTCTCACAACCAGG + Intergenic
934932406 2:98437164-98437186 CTGGTTCTTGTCACAAGACCAGG - Intergenic
935162372 2:100540408-100540430 TAAGTTATTGTCTAAAGACCTGG + Intergenic
935518706 2:104077988-104078010 CAAGTTCTTGTCCTGCGACCAGG + Intergenic
935797830 2:106662842-106662864 CAAGTTCCTCTCTCAATACCAGG - Intergenic
935963008 2:108445649-108445671 TGGGTTCTTTTCTCATGACCAGG - Intergenic
936271668 2:111053920-111053942 CTAGCTCTTGTCTCCTGACCTGG - Intronic
936832084 2:116659123-116659145 CCAGTTCTTGTCTCATGACCAGG + Intergenic
936834314 2:116689022-116689044 TGAATTCTTGTCTCACGACCAGG + Intergenic
937891180 2:126940180-126940202 CAAGTTCTTGTCCAGTGTCCAGG + Intergenic
938096383 2:128466907-128466929 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
939017578 2:136920160-136920182 CAAGTTCTTGTCCCATGTTCAGG + Intronic
939084905 2:137707734-137707756 CAAGTTCTTGTCCTATGTCCAGG + Intergenic
939356746 2:141112141-141112163 TGGGTTCTTGTCTCATGACCAGG - Intronic
939384290 2:141475933-141475955 CAGGTTCTTGTCTGGTGTCCAGG - Intronic
939393178 2:141594267-141594289 CAAGTTCTTGTCTCACAACCAGG - Intronic
939419156 2:141943820-141943842 CGGGTTCTTGTCACACGACCAGG + Intronic
939460124 2:142488398-142488420 CAAGTTCTTGTCTGGTGTCCAGG - Intergenic
940398622 2:153222078-153222100 CAAGTTCTTGTCCCACACCCAGG + Intergenic
940694204 2:156958944-156958966 CAAGTTCTTGTCCCGTGTACAGG + Intergenic
941200040 2:162496618-162496640 TGGGTTCTTGTCTCATGACCAGG - Intronic
941262553 2:163316060-163316082 CAGGTTTTTGTCTCACAACCAGG + Intergenic
941404869 2:165075214-165075236 CAAGTTCTTGTCCCACATCCAGG - Intergenic
941929152 2:170923792-170923814 CAAGTTCTTGTCCCATATCCAGG + Intergenic
942114291 2:172712844-172712866 CAAGTTCTTGTCCCACATCCAGG + Intergenic
942315427 2:174692926-174692948 CAAGTTCTTGTCCCACATCCAGG - Intergenic
942619724 2:177834160-177834182 TGGGTTCTTGTCTCATGACCAGG - Intronic
942867993 2:180699246-180699268 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
943023418 2:182601543-182601565 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
943149828 2:184097939-184097961 CATGTTCTAGTCTCAAGACCAGG - Intergenic
943180184 2:184530709-184530731 CAAGTTCTTGTCTGGTGTCTAGG + Intergenic
943481213 2:188420543-188420565 TGAGTTCTTGTCCCGTGACCAGG + Intronic
943846503 2:192655884-192655906 CAGGTTCTTGTCACACGACCAGG + Intergenic
943928448 2:193819297-193819319 CAAGTTCTTGTCCCGTGTCCAGG + Intergenic
944022637 2:195125271-195125293 AAAGTTCTTGTCCCATGTCCTGG + Intergenic
944901741 2:204223011-204223033 CAAGTTCTTGTCCTGTGACTAGG + Intergenic
944960085 2:204862765-204862787 CAGGTTCTTGTCACACGACCAGG + Intronic
945369828 2:209003372-209003394 CAAGTTCTTGTCTCACAACCAGG - Intergenic
945370220 2:209006763-209006785 CAAGCTATTGTCTCACAACCAGG - Intergenic
946652924 2:221913707-221913729 CAGGTTCTTGTCACATGACCAGG + Intergenic
946815669 2:223576007-223576029 TAAATGCTTTTCTCATGACCTGG - Intergenic
946873764 2:224108123-224108145 CTGGTTCTTGTCACATGACCAGG + Intergenic
947054760 2:226087660-226087682 TAAGTTCTTGTCCCATTTCCAGG + Intergenic
948334875 2:237200121-237200143 CAAGTTCTTGCCCCATGTCCAGG + Intergenic
948434609 2:237944586-237944608 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
948748655 2:240114102-240114124 CAGGTTTCTGTCTCTTGACCTGG - Intergenic
1168983359 20:2026541-2026563 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1169324523 20:4664525-4664547 CAAGTTCTTGTTTGGTGTCCAGG + Intergenic
1169880556 20:10342008-10342030 CAAGTTCTTGTCCCACATCCAGG - Intergenic
1169940683 20:10933966-10933988 CAGCTTCTTGTCACATGACCAGG + Intergenic
1170004236 20:11647571-11647593 CAAATTCTTGTCTTGTGAACAGG - Intergenic
1170220606 20:13937584-13937606 CAGGTTCTTGTCACACGACCAGG - Intronic
1170244453 20:14205296-14205318 TGGTTTCTTGTCTCATGACCAGG + Intronic
1170289607 20:14753897-14753919 CAAATTTTTGTTTCATGAACTGG + Intronic
1170334070 20:15248888-15248910 CAAGTACTTGTCTCATTCTCAGG - Intronic
1170335718 20:15267989-15268011 TGGGTTCTTGTCACATGACCAGG - Intronic
1170944129 20:20874826-20874848 CAAGTTCTATTCTCTTGACCTGG - Intergenic
1170946970 20:20900257-20900279 CTGGTTTTTATCTCATGACCAGG + Intergenic
1171887727 20:30671521-30671543 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1173107557 20:40152037-40152059 CCAGTTCTTGACTCAGGACATGG - Intergenic
1173207544 20:41006701-41006723 TGAGTTCTTGTCCCATGCCCGGG + Intergenic
1173315916 20:41942932-41942954 CCTGTTTGTGTCTCATGACCTGG + Intergenic
1173884494 20:46445543-46445565 CAAGTTCTTGTCCTATAACCAGG + Intergenic
1174005217 20:47405329-47405351 CAAATGGTTGTCTCAGGACCAGG + Intergenic
1174544098 20:51312360-51312382 AGGGTTCTTGTCACATGACCAGG + Intergenic
1175027779 20:55921246-55921268 CTGGTTCTTGTCTCATACCCAGG + Intergenic
1175138622 20:56843208-56843230 CAAGTGCTTATCCCATGCCCAGG - Intergenic
1176851759 21:13923604-13923626 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1177172193 21:17667215-17667237 CGAGTTCTTGTCTCACAACCAGG + Intergenic
1177357768 21:20031294-20031316 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1177404382 21:20646263-20646285 CAAGTTCTTGTCTCACATCCAGG - Intergenic
1177414364 21:20775655-20775677 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1177549511 21:22601673-22601695 CATGTTCTTGTCTCACAACCAGG + Intergenic
1177567347 21:22842867-22842889 CAGGTTCTTGTGTCATAATCGGG + Intergenic
1177878148 21:26659978-26660000 CAAGTTCTTGTCTCATGACCAGG - Intergenic
1177900928 21:26914174-26914196 CGGGTTCTTGTCTCATGACCAGG - Intergenic
1178103532 21:29295654-29295676 CAAGTTCTTGTCTCACAACCAGG - Intronic
1178223696 21:30689823-30689845 CAAGTTCTTGTCTGGTGTTCAGG - Intergenic
1179140515 21:38721051-38721073 CAGGGTCTTGTCACATGACCAGG + Intergenic
1179558738 21:42198476-42198498 CACATTCTTGTCCCATAACCTGG + Intergenic
1180153107 21:45962506-45962528 TGGGTTCTTGTGTCATGACCAGG + Intergenic
1180178855 21:46108866-46108888 CAAGTTCTTGTCCTGTGTCCAGG + Intronic
1180539048 22:16424150-16424172 CAGGTTCTTGTCACACCACCAGG + Intergenic
1181491603 22:23263703-23263725 CAAGTACTGGGCTCATGAACAGG + Intronic
1182867750 22:33619140-33619162 TGGGTTCTTGTCTCGTGACCAGG - Intronic
1183562343 22:38585171-38585193 CTATTCCTTGTCTCATGAACTGG + Intronic
1183759104 22:39799432-39799454 CAGGTTCTTGTCTCATGACCAGG + Intronic
1184319717 22:43731219-43731241 CAAGGTTATGTCTAATGACCTGG + Intronic
1184704795 22:46203553-46203575 TGGGTTCTTGTGTCATGACCAGG + Intronic
1184754876 22:46510033-46510055 CATGTTCTTGCCTCCTGCCCTGG - Intronic
949095152 3:77084-77106 TGGGTTCTTGTCACATGACCAGG + Intergenic
949166926 3:954224-954246 CTGGTTCTTGTCACACGACCAGG + Intergenic
949257294 3:2063795-2063817 AAAGTTTTTGTCTTGTGACCGGG - Intergenic
949785224 3:7733228-7733250 CAGGTTCTTATCTCACAACCAGG + Intronic
951182228 3:19671962-19671984 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
951303535 3:21028387-21028409 CAGGTTTTTGTCACATGGCCAGG + Intergenic
951509614 3:23486592-23486614 CAAGTTCTTGTCCCACGTCTGGG + Intronic
952080084 3:29747620-29747642 TGGGTTCTTTTCTCATGACCAGG + Intronic
952108279 3:30093504-30093526 TGGGTTCTTGTCTCATGACCAGG + Intergenic
952181467 3:30920826-30920848 CAAGCTCTTGTCTGGTGTCCAGG - Intergenic
952325112 3:32313823-32313845 CATGTTCTTGTCACACGACCAGG + Intronic
952636989 3:35544890-35544912 TGGGTTCTTGTCACATGACCAGG + Intergenic
953337069 3:42102515-42102537 AAGGTTCTTGTCTCATGACCAGG + Intronic
953441092 3:42918232-42918254 TGGGTTCTTGTCTCATGACCAGG + Intronic
953603119 3:44387329-44387351 CAAGTTCTTGTCCCATGTCCAGG - Intronic
953647439 3:44768346-44768368 CAAGTTCGTGTTGCATGACCAGG + Intronic
953648094 3:44773814-44773836 CAGGTTCTTGTCGCATGACCAGG + Intronic
955304195 3:57813450-57813472 CAATTTATAGTCTCATGTCCAGG + Intronic
955432189 3:58857994-58858016 GAAGTTAGTGTATCATGACCTGG + Intronic
955578972 3:60398102-60398124 CGAGTTCTTGTCTCACAACCAGG - Intronic
955733372 3:62010908-62010930 CAGGTTCTTGTCTCATGACCAGG + Intronic
955909820 3:63848360-63848382 TAAGTTATTGTCTGAAGACCTGG - Exonic
956158466 3:66323381-66323403 CAAGTTCTTGCCTGCTGCCCAGG + Intronic
956251081 3:67234845-67234867 TAAGTTCTTGTCACATCCCCAGG + Intergenic
957028248 3:75209457-75209479 CAGGTTCTTGTCACATGACCAGG - Intergenic
957459350 3:80497055-80497077 CAAGTTCTTGCCTCATATCCAGG + Intergenic
957991894 3:87636592-87636614 CAGGTTCTTGACTCATGACCAGG - Intergenic
958047986 3:88308058-88308080 CAGATTCTTGTCATATGACCAGG - Intergenic
958536217 3:95408028-95408050 CAGGTTCTTATCACATGACCAGG - Intergenic
958536722 3:95412890-95412912 TCGGTTCTTGTCACATGACCAGG - Intergenic
958572882 3:95911177-95911199 CAAGTTCTTGTCCTCTGACCAGG + Intergenic
959158177 3:102692645-102692667 TGGGTTCTTGTCCCATGACCAGG + Intergenic
959429661 3:106236857-106236879 CAGGTTCTTGTCTCACGATCAGG - Intergenic
959486808 3:106936231-106936253 CCAGTTCTTGTCACATGACCAGG + Intergenic
959660573 3:108863722-108863744 CGGGTTCTTGTCACATGACCAGG + Intergenic
959685354 3:109140221-109140243 CAGGTTCTTGTCATGTGACCAGG + Intergenic
959868003 3:111292893-111292915 CAAGTTCTTCTTCCATGATCTGG + Intronic
962582572 3:136811684-136811706 CAGCGTATTGTCTCATGACCAGG + Intergenic
962763792 3:138542778-138542800 CAAGTTCTTGTCCTGTGTCCAGG + Intronic
962824473 3:139088035-139088057 CAAGTTCTTGTCTTGTGCCCAGG + Intronic
963346327 3:144099692-144099714 CAAGTTCTTGTCCCATGCCCAGG - Intergenic
964133264 3:153314889-153314911 CAAGTTCTTGTCTCACAACCAGG + Intergenic
964314261 3:155426696-155426718 TGGGTTCTTGTCTCATGACAAGG + Intronic
964362036 3:155908463-155908485 CGGGTTCTTTTCACATGACCAGG - Intronic
964762257 3:160145708-160145730 CAAGCTCCAATCTCATGACCTGG + Intergenic
964927785 3:161978624-161978646 CAAGTTCTTGTCCCACATCCAGG + Intergenic
965073922 3:163953092-163953114 CGAGTTCTTTTCCCATGTCCGGG + Intergenic
965117859 3:164515062-164515084 CCAGTTCTTGTCCCATGTCCTGG + Intergenic
965118558 3:164521707-164521729 TAAGTTCTTGTCTCATATCTAGG + Intergenic
965178471 3:165367247-165367269 TGGGTTCTTGTCCCATGACCAGG + Intergenic
965206104 3:165720411-165720433 CAAATTCTTGTCCCGTGTCCAGG + Intergenic
965367822 3:167821157-167821179 CAGGTTCTTGTCTCACATCCAGG - Intronic
966838679 3:184069773-184069795 CAAATTCTTATGTCATGACTAGG - Intergenic
966840203 3:184081901-184081923 CAAGTTCTTGTCCTGTGTCCTGG - Intergenic
967055767 3:185826687-185826709 CAAGTTCGGGTCTCCTGACTGGG + Intergenic
967546197 3:190731847-190731869 CAGGTTCTTGTCACACAACCAGG + Intergenic
967649820 3:191973090-191973112 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
967761125 3:193227425-193227447 CAGGTTCTTGTCACACAACCAGG - Intergenic
967763150 3:193247564-193247586 TGGGCTCTTGTCTCATGACCAGG - Intronic
968142896 3:196273404-196273426 CGAGTTCTTGTCCCACGTCCAGG + Intronic
968381592 4:101286-101308 TGGGTTCTTGTCACATGACCAGG - Intergenic
968393402 4:211655-211677 CAGGCTCTCGTCCCATGACCTGG - Intergenic
968538582 4:1150620-1150642 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
968838278 4:2981311-2981333 CAAGTTCTTGTCCCATGTCCAGG + Intronic
969073775 4:4561011-4561033 CAGGCTCTTGTCACACGACCAGG + Intergenic
969179286 4:5424713-5424735 CAAGTTCTTGTCCTGTGTCCAGG - Intronic
969884201 4:10200778-10200800 CAGGTGCTTTTCTTATGACCTGG + Intergenic
970247800 4:14081464-14081486 GAAGTTCTTATCTCATGAAATGG - Intergenic
970272421 4:14361265-14361287 GAAGTTTTTGTCACGTGACCAGG - Intergenic
970720938 4:18987736-18987758 CAAGTTCTTGTCCAGTGTCCTGG - Intergenic
970729920 4:19090578-19090600 CAGATTCTTGTCACATGACCAGG - Intergenic
971669767 4:29542285-29542307 CAAGTTCTTGTCTCATGTCCAGG + Intergenic
971876787 4:32318531-32318553 CAACTTCTTGTCTCATGTCCAGG + Intergenic
971927908 4:33037883-33037905 CAGGTTCTTGTCACAGGACCAGG - Intergenic
972108152 4:35519996-35520018 CAGGTTATTGTCTCATGATCAGG + Intergenic
972394626 4:38648428-38648450 CAAATTCTTTTCTCTTGGCCAGG + Intergenic
972930972 4:44071342-44071364 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
973238596 4:47932710-47932732 CAAGTTCTTGTCTCATGACCAGG + Intronic
973285013 4:48405191-48405213 CAAGTTCTAGTCTCCTGATATGG - Intronic
973384366 4:49495303-49495325 TGGGTTCTTCTCTCATGACCAGG - Intergenic
974174962 4:58309898-58309920 CAAGTTCTTGTCTGGTGTCCAGG + Intergenic
974256301 4:59459344-59459366 CGAGTTCTTGTCACACAACCAGG + Intergenic
974420200 4:61663089-61663111 CGAGTTCTTGTCCCATGTTCAGG - Intronic
974421575 4:61683352-61683374 CAAGTTCTTGTCTCACAACCAGG + Intronic
974610109 4:64206025-64206047 CAGGTTCTTGTCTGGTGTCCAGG + Intergenic
974697985 4:65398931-65398953 GAAGTTCTTATCTCATGCTCAGG - Intronic
974801913 4:66828710-66828732 CAAGTCCTTCTCCCATGATCTGG + Intergenic
974857314 4:67476402-67476424 TAAATCCTTCTCTCATGACCTGG - Intronic
975008545 4:69321196-69321218 CAAGTTCTTGTCTTGTGACCAGG - Intronic
975023608 4:69521183-69521205 TGAGTTCTTGTCCCATGTCCAGG - Intronic
975098709 4:70487546-70487568 TGAGTTCTTGTCTCACAACCAGG - Intergenic
976129736 4:81871375-81871397 CGAGTTCATGTCCCATGTCCAGG - Intronic
976461858 4:85320935-85320957 CAAGTTCTTGTCTCATGACCAGG + Intergenic
976647407 4:87400292-87400314 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
976675407 4:87697373-87697395 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
976751538 4:88455263-88455285 CAGGTTCTTGTCTCATGACCAGG + Intergenic
976778023 4:88727761-88727783 CAGGCTCTTCTCCCATGACCTGG + Exonic
977254702 4:94727763-94727785 CAGGTTCTTGTCTGGTGTCCAGG - Intergenic
977823461 4:101502803-101502825 CAGGCTCTTGTCACATGACCAGG - Intronic
978248511 4:106603951-106603973 CGAGTTCTTGTCCTATGTCCAGG + Intergenic
978328474 4:107586254-107586276 TGGGTTCTTGTCACATGACCAGG + Intergenic
978347595 4:107788238-107788260 TGAGTTCTTGTCCCATGTCCAGG + Intergenic
978749334 4:112229318-112229340 CAGGTTCTTGTCACATGACAAGG - Intergenic
978822230 4:112979583-112979605 CAAATTCTTGTCCCATGCCTAGG + Intronic
979090518 4:116477606-116477628 CAAGTTCTTGTCCCATGTGCAGG + Intergenic
979136714 4:117119035-117119057 CAAGTTCTTGTCCCACGTCCAGG + Intergenic
979448158 4:120839263-120839285 CAAATTCTTGTCCTGTGACCAGG + Intronic
979462920 4:121003866-121003888 CAAGTTCTTGTCCTATGACCAGG - Intergenic
979609383 4:122673274-122673296 CAGTTTCTTGTCACTTGACCAGG + Intergenic
980287477 4:130799160-130799182 CGGGTTCTTGTCTCACAACCAGG + Intergenic
980701990 4:136442937-136442959 CAAGTTCTTGTCCTGCGACCGGG - Intergenic
980729760 4:136811180-136811202 CAATTTCTTGTCCTGTGACCAGG + Intergenic
981297321 4:143147041-143147063 CAAGTTCTTGTCTGGTGTCCAGG - Intergenic
981456007 4:144954019-144954041 CAGGTTCTTGTCACACGACCAGG - Intergenic
981456904 4:144962880-144962902 CAGGTTCTTGTCATATGAACAGG - Intergenic
981478739 4:145214058-145214080 CGAGTTCTTGTCTCACATCCAGG + Intergenic
981491151 4:145340704-145340726 CAGGTTCTTGTCACATGACCAGG - Intergenic
981764211 4:148229409-148229431 CAGGTTCTGATCTCATGACCAGG - Intronic
981770783 4:148304977-148304999 TGGGTTCTTGTGTCATGACCAGG - Intronic
981889149 4:149715644-149715666 GGAGTTCTTGTCCCATGTCCAGG + Intergenic
982157984 4:152540085-152540107 CAAGTTCTTGTCCCGTGACCAGG + Intergenic
982521172 4:156418103-156418125 TGGGTTCTTGTCTCATGACCAGG - Intergenic
982614317 4:157621829-157621851 TAAGTTATTGTCTCAAGACCTGG + Intergenic
982856165 4:160385298-160385320 CAAATTCTTGTCCCATGTCCAGG + Intergenic
982863117 4:160479436-160479458 CAGGTTCTTGTCTCAAGACCAGG + Intergenic
982959823 4:161822765-161822787 TGAGTTCTTGTCTCACGTCCAGG + Intronic
983040660 4:162921534-162921556 CGGGTTCTTGTCACATGACAAGG - Intergenic
983040672 4:162921616-162921638 CAGGTTCTTATCACATGACCAGG - Intergenic
983431051 4:167652068-167652090 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
983491977 4:168399126-168399148 CAAGTTCTTGTCCCGTATCCAGG - Intronic
983552707 4:169033652-169033674 CAGGTTCTTGTCACACGACCAGG + Intergenic
983705096 4:170648139-170648161 TGGCTTCTTGTCTCATGACCAGG + Intergenic
984118473 4:175711896-175711918 ACTGTTCTTGTCACATGACCAGG - Intronic
984292056 4:177808113-177808135 CGAGTTCTTGTCTGGTGTCCAGG + Intronic
984325266 4:178242539-178242561 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
984327357 4:178271195-178271217 CAGGTTCTTGTTTCATGACCAGG - Intergenic
984327943 4:178276337-178276359 TGAGTTCTTATCTTATGACCAGG - Intergenic
984337902 4:178415778-178415800 CTAGTTCTTGTCCCATGTCCAGG - Intergenic
984375394 4:178922692-178922714 CAAGTTCTTGTCCCACATCCAGG - Intergenic
984763868 4:183384778-183384800 CAAGTTCTTGTCCCACGTCCAGG - Intergenic
985048887 4:185970260-185970282 CGAGTTCTTGTCTGGTGTCCAGG + Intergenic
985227445 4:187777918-187777940 CAGGCTCTTGTCCCATGACAAGG + Intergenic
985495949 5:206119-206141 CAAGTTCTTATCTGAAAACCAGG + Intronic
985752915 5:1692616-1692638 CGAGTTCTTGTCTGGTGTCCAGG + Intergenic
985916262 5:2921197-2921219 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
985919926 5:2962472-2962494 CTGGTTCTTGTCTCATGACCAGG + Intergenic
986556708 5:9017058-9017080 CAATTCCTTCTCTAATGACCAGG - Intergenic
986588719 5:9346389-9346411 CAAGCTCTTGTCTGGTGTCCAGG - Intronic
986683574 5:10255601-10255623 CACGTTTTAGTCTCATCACCAGG + Intronic
986831084 5:11579235-11579257 CAAGTTCTTGTTTGATTAGCAGG - Intronic
987190208 5:15469841-15469863 CCAGTTCTTGTCCAATGTCCAGG + Intergenic
987358357 5:17084520-17084542 CGGGTTCTTGTCTCACGACCAGG + Intronic
987570743 5:19654691-19654713 CAGGTTCTTGTCTGGTGTCCAGG + Intronic
987875462 5:23675228-23675250 CAAGTTCTTGTCACATGTCCAGG - Intergenic
988069867 5:26274028-26274050 CAGGTTCTCGTCTCATGACGAGG - Intergenic
988127317 5:27057875-27057897 CAAGATGTGGTCTCAAGACCTGG - Intronic
988157900 5:27477915-27477937 TAGGTTCTCGTCACATGACCAGG - Intergenic
989282788 5:39664921-39664943 CAAGTTCTTGTTCCATATCCAGG - Intergenic
989520730 5:42397032-42397054 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
989715076 5:44453730-44453752 CAGGTTTTTGTTACATGACCAGG + Intergenic
989715572 5:44458475-44458497 CGGGTTTTTGTCACATGACCAGG + Intergenic
990079828 5:51899397-51899419 CAAATTCTTGTCTGGTGACCAGG + Intergenic
990176959 5:53118728-53118750 CAGGTTCTTGTTTCATGACCAGG + Intergenic
990569949 5:57068043-57068065 CAGGTTCTTTTCTCATGACCAGG - Intergenic
990878825 5:60517799-60517821 CAAGTTCTTGTCCTGTGTCCTGG - Intronic
991082991 5:62621255-62621277 CAGGTTCTTGTCACACGACCAGG + Intronic
993703301 5:91143362-91143384 CAAGTTCTTGTCCCATGCCCAGG + Intronic
993728664 5:91397134-91397156 TTGGTTCTTGTCACATGACCAGG + Intergenic
994323914 5:98426662-98426684 CAAGTGCTTGTCTTATGCACAGG - Intergenic
994449884 5:99929006-99929028 CAAGTTCTTATCATATGACTAGG + Intergenic
994453943 5:99981394-99981416 CAGGTTCTTTTCTCGCGACCAGG - Intergenic
994493510 5:100479230-100479252 CAAGTTCTAGGATTATGACCAGG - Intergenic
994724736 5:103421169-103421191 CTAATTCTGGTCTCATAACCAGG - Intergenic
994913115 5:105938972-105938994 TGGGTTCTTGTCACATGACCAGG + Intergenic
994948128 5:106423058-106423080 CGAGTTCTTGTCCCATGTCCAGG - Intergenic
995863039 5:116661605-116661627 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
995927071 5:117386845-117386867 CGAGTTCTTGTTCCATGACCAGG - Intergenic
996677054 5:126188285-126188307 CGAGTTCTTGTCACAGGACCAGG - Intergenic
996890315 5:128411324-128411346 CAAATTCTTGTCTGGTGTCCAGG + Intronic
996955389 5:129177393-129177415 CAGGTTCTTGTCTCACAACCAGG + Intergenic
998641147 5:144012814-144012836 CAGGTTCTTGTCACATGAGTAGG + Intergenic
998703587 5:144732737-144732759 TAAGTTCTTCCCTCATGATCTGG + Intergenic
998856400 5:146398995-146399017 CAAGTTCTTGTCTGGTGTCCAGG - Intergenic
999273790 5:150314705-150314727 GAAGCTCTTGGCTCAGGACCTGG + Intronic
1000234428 5:159344456-159344478 CAGGTTCTTGTCCTATGTCCAGG + Intergenic
1000426273 5:161094235-161094257 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1000740810 5:164968378-164968400 CAGGTTATTGCCTCAAGACCGGG + Intergenic
1000741631 5:164975924-164975946 CAGGTTCTTGTCTCACAATCAGG + Intergenic
1001015048 5:168133124-168133146 CAAGTTTGTGTATCATGCCCTGG - Intronic
1002677977 5:180934896-180934918 CAAGTTCTTGTCCCATATCCAGG + Intronic
1002762673 6:214148-214170 CAGGTCCTTGTCCCATGTCCAGG - Intergenic
1002788624 6:423109-423131 CAATGTTTTGTATCATGACCTGG - Intergenic
1002986288 6:2192381-2192403 TGAGTTCTTGTCTTGTGACCAGG - Intronic
1004304570 6:14488206-14488228 CAAGTTCTTGTCCTGAGACCAGG - Intergenic
1005055176 6:21722478-21722500 CAGGTTCTTGTCACACAACCAGG + Intergenic
1005564680 6:27079009-27079031 CGGGTTCTTGTCACATAACCAGG - Intergenic
1005981540 6:30840615-30840637 CGGGTTCTTGTCACATGACCAGG + Intergenic
1007009510 6:38401583-38401605 CTACTTCTTGTCTCTTTACCAGG - Intronic
1007373856 6:41443420-41443442 CAAGTTCTTGTAACTTGAGCCGG + Intergenic
1009196788 6:60695915-60695937 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1009243317 6:61204628-61204650 TGAGTTCTTGTCCCATGTCCAGG + Intergenic
1009534265 6:64860747-64860769 TGAGTTCTTGTCCCATGCCCAGG + Intronic
1009735950 6:67675731-67675753 TGAGCTCTTGTCTCATGACCAGG + Intergenic
1009846847 6:69145589-69145611 CAAGTTATTGTCCCATGTCCAGG + Intronic
1010039815 6:71368157-71368179 CCAGTTCTTGTCTTACAACCAGG - Intergenic
1010534639 6:77011945-77011967 CAAGTTCTTGTCTCATGTTCAGG - Intergenic
1010570961 6:77474391-77474413 CGAGTTCTTGTCTCACAACTAGG - Intergenic
1010695554 6:78969865-78969887 CAAATTGTTGTCTCAAGACTAGG + Exonic
1010809723 6:80287527-80287549 CAGGTTCTTGTCTCCCAACCAGG + Intronic
1010872995 6:81064526-81064548 CGGGTTCTTGTCACACGACCAGG + Intergenic
1010887548 6:81263163-81263185 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
1011285851 6:85721835-85721857 CAAGTTTTCATCTCATGCCCAGG + Intergenic
1011293921 6:85807165-85807187 CAAGTTCTTCCCTCAACACCTGG + Intergenic
1012143319 6:95650585-95650607 TGTGTTCTTGTCTCATGATCAGG - Intergenic
1012595488 6:101032966-101032988 CAGGTTCTTGTCTAATGACCAGG - Intergenic
1012629171 6:101442187-101442209 CAGGTTCTTGTCACAGGACCAGG + Intronic
1012804819 6:103879993-103880015 TAGGTTCTTGTCACGTGACCAGG - Intergenic
1013437388 6:110124440-110124462 CAGGTTCTTGTCTCACGATGAGG - Intronic
1014953849 6:127592890-127592912 CGTGTTCCTGTCACATGACCAGG + Intergenic
1014956340 6:127621514-127621536 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1015096162 6:129417179-129417201 CAAGTTCTTGTCCCACATCCTGG + Intronic
1015681437 6:135813161-135813183 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1016210889 6:141531969-141531991 CAAGTTCTTGTTCCATGTCCAGG - Intergenic
1016559295 6:145377447-145377469 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1016618319 6:146078882-146078904 CAGGTTCTTGTCACACCACCAGG + Intronic
1016756391 6:147692326-147692348 CAATTCCTTGTATCAAGACCAGG - Intronic
1017522292 6:155213183-155213205 CGAATTCTTGTCCCATGACCAGG + Intronic
1019042331 6:169117569-169117591 CAAGTCCTTGTCTGATGTCCAGG - Intergenic
1019434564 7:1015377-1015399 CAAGTCCCTGTCTCATGAACAGG + Intronic
1019946116 7:4330706-4330728 TAAGTTGTTGTCTGAAGACCAGG - Intergenic
1020596220 7:10211606-10211628 CAGGTTCTTCTCTCACAACCAGG + Intergenic
1020596607 7:10214171-10214193 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1020913072 7:14157998-14158020 CAAATCCTTGCCTCATGTCCTGG - Intronic
1020956530 7:14745819-14745841 CAGGTTCTTGTCTCATGACCAGG - Intronic
1021021077 7:15599535-15599557 CAATTTCTTGTTTCATGCCCAGG + Intergenic
1021092716 7:16502134-16502156 CGAGTTCTTGTCCAATGTCCAGG - Intronic
1021101202 7:16586985-16587007 CAGGTTCTCGTCTCACAACCAGG + Intergenic
1021103624 7:16612031-16612053 CAAGTTCTTGTCTTACAACCAGG - Intronic
1021147001 7:17101426-17101448 TGAGTTCTTGTCTCACAACCAGG + Intergenic
1021267306 7:18540453-18540475 CAAGTTCTTGTCTACTGGCAAGG - Intronic
1021269964 7:18573999-18574021 CGAGTTCTTGTTTCATACCCAGG + Intronic
1021420801 7:20443024-20443046 CGAGTTCTTGTCTGGTGTCCAGG - Intergenic
1021431081 7:20559835-20559857 CAACTTCTTCTCCCATGCCCAGG + Intergenic
1021585334 7:22201810-22201832 AAAGTTCTTGGCTGATGACCAGG + Intronic
1021648375 7:22808544-22808566 CAGGTTCTTGTGTCATGACCAGG - Intergenic
1021874486 7:25035965-25035987 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1022391945 7:29950925-29950947 CAAGCTCTTGTCCCATGTTCAGG - Intronic
1022591835 7:31671111-31671133 CAAGTTCTTGTCCACTGTCCAGG - Intergenic
1022657280 7:32331023-32331045 CAAGGTCTTGCCTCTTGCCCAGG - Intergenic
1023488962 7:40717229-40717251 CAGGCTCTTGTCACACGACCAGG + Intronic
1023699473 7:42878237-42878259 CAAGTTCTTCTCCTGTGACCAGG - Intergenic
1024023031 7:45388063-45388085 CACGTCCTTGTCTCATTGCCAGG - Intergenic
1024438139 7:49382606-49382628 CAGGTTTTTGTTTCACGACCAGG - Intergenic
1024743642 7:52382755-52382777 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1026393546 7:69928009-69928031 CAAGTTCTTGTCTCACATCCAGG + Intronic
1027287742 7:76666217-76666239 TGGGTTATTGTCTCATGACCAGG - Intergenic
1027681938 7:81232855-81232877 CAAGTTCTTGTCCCACATCCGGG + Intergenic
1028052201 7:86202304-86202326 CAACTTCTTGTCCCACAACCAGG + Intergenic
1028136820 7:87231016-87231038 CGAGTTCTTGTCCCATGTACAGG - Intergenic
1028233379 7:88330996-88331018 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1028401902 7:90433589-90433611 TGAGTTCTTGTCTCATGTCCAGG + Intronic
1028849770 7:95525029-95525051 TGGGTTCTTGTCACATGACCAGG - Intronic
1029002453 7:97168187-97168209 CAAGTTCTTGTCTCATGACCAGG - Intronic
1030041368 7:105453300-105453322 CAAGTTCTTATGTCATGACCAGG - Intronic
1030064254 7:105647199-105647221 CTAGTTCTTGTTGCATGAGCTGG + Intronic
1030114316 7:106051532-106051554 TGGGTTCTTGTCTCACGACCAGG + Intergenic
1030359505 7:108580138-108580160 GGAGTTCTTGTCCCATGTCCAGG - Intergenic
1030484431 7:110148546-110148568 CAAGTTCTTGTCCCACATCCAGG + Intergenic
1030496621 7:110308801-110308823 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1030593434 7:111508446-111508468 CGAGTTCTTGTCGCACAACCAGG + Intronic
1031112609 7:117630460-117630482 CGGGTTCTTGTCACATGATCCGG + Intronic
1031174158 7:118328555-118328577 CAAGTTCTTTTCTCATGAACAGG + Intergenic
1031616481 7:123887883-123887905 CAGGCTCTTGACTCATGACCAGG - Intergenic
1031786651 7:126041396-126041418 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1032250914 7:130256547-130256569 CAGGTTCTTGTCACAAGACTGGG - Intergenic
1032329223 7:130962276-130962298 TGGGTTCTTGTCACATGACCAGG + Intergenic
1032580050 7:133096079-133096101 TAAGTTCTTGTCACACGACCAGG + Intergenic
1032591129 7:133193472-133193494 CAAGTTCTTGTCCTGTGTCCAGG + Intergenic
1032919222 7:136527129-136527151 TGAGTTCTTGTTTCATGTCCAGG + Intergenic
1033865567 7:145687077-145687099 CAGGTTCTTGTCAGATGACGTGG - Intergenic
1034252138 7:149701229-149701251 CCAGTTCTTGTCCCATGTCCAGG + Intergenic
1034675104 7:152887255-152887277 CAAGGTCTTGTATGTTGACCTGG + Intergenic
1035418407 7:158707690-158707712 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
1035494403 7:159310620-159310642 CAAGTTCTTGTCCCACAACGAGG + Intergenic
1037103613 8:15078230-15078252 TGGGTTCTTGTCTCATGACCAGG - Intronic
1037259865 8:16996248-16996270 GAGGTCCTTGTCACATGACCAGG - Intronic
1038370298 8:26982146-26982168 CGGGTTCTTGACACATGACCAGG - Intergenic
1038871109 8:31494920-31494942 TGAGTTCTTGTCAAATGACCAGG + Intergenic
1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG + Intronic
1039743219 8:40401022-40401044 TAGGTTCTTGTCTCATAACCAGG + Intergenic
1039802384 8:40970622-40970644 CAGGTTCTTGTCACACAACCAGG + Intergenic
1040662959 8:49596747-49596769 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1040919330 8:52599325-52599347 CAGTTTCTTGTCCCATGACCAGG - Intergenic
1040997259 8:53414264-53414286 CAGGCTCTTGTCACACGACCAGG + Intergenic
1041351627 8:56952800-56952822 CAGGTTCTTGTCTCATGACGAGG - Intergenic
1041956143 8:63559506-63559528 CAAGTTCTTGTCCCACATCCAGG + Intergenic
1041965424 8:63669882-63669904 TGTGTTCTTGTCTCATGTCCAGG + Intergenic
1042004967 8:64169765-64169787 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1042081591 8:65060015-65060037 TGAGTTCTTGTCTGATGTCCAGG - Intergenic
1042264268 8:66892403-66892425 CAAGTTCTTGTTCCACGTCCAGG + Intronic
1042427130 8:68661428-68661450 CGGGTTCTTGTCTCACAACCAGG + Intronic
1042625169 8:70749207-70749229 CAAGTTCTTGTCCCACATCCAGG - Intronic
1043065655 8:75567514-75567536 TAACTCCATGTCTCATGACCAGG + Intergenic
1043690891 8:83150124-83150146 TGGGTTCCTGTCTCATGACCAGG - Intergenic
1043695261 8:83208968-83208990 CAAGTTCTTGTCCCATATCCAGG - Intergenic
1043734972 8:83730711-83730733 CAAGCTCTTGTCACATGCCCAGG + Intergenic
1044053703 8:87542281-87542303 TGAGTTCTTGTCCCATGTCCAGG + Intronic
1044132926 8:88548963-88548985 TGAGTTCTTGTCTCACAACCAGG + Intergenic
1044740719 8:95323511-95323533 TGGTTTCTTGTCTCATGACCAGG + Intergenic
1045191541 8:99889063-99889085 TGGGTTCTTGTGTCATGACCAGG - Intronic
1045300673 8:100907811-100907833 CGAGTTCTTGTCGCAAGTCCAGG + Intergenic
1045670953 8:104552971-104552993 CAAGTTCTTTTCCCATGATCTGG - Intronic
1046186980 8:110734440-110734462 CAAATTCTTTTCCCATGTCCGGG + Intergenic
1046337791 8:112813024-112813046 CGAGTTCTTGTCACACGACCAGG + Intronic
1046406255 8:113776225-113776247 TAAGTTCTTGTCTCACAACCAGG - Intergenic
1046508909 8:115173223-115173245 CGGCTTCTTGTCTCACGACCAGG - Intergenic
1048175583 8:132149454-132149476 CGGGTTCTTGTCACATGACCAGG - Intronic
1048176216 8:132154839-132154861 TGAGTTCTTCTCACATGACCAGG - Intronic
1048421642 8:134283648-134283670 CAAGTTCTTGTCCTGTGGCCAGG + Intergenic
1049346350 8:142141147-142141169 CAAGGTCTTGTCTCCTCACCTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049826791 8:144674208-144674230 CAAGTTCCTGTCACATGTCCAGG + Intergenic
1050130548 9:2407271-2407293 CAAGTTCTTGTACTGTGACCAGG - Intergenic
1050785275 9:9393137-9393159 CAGGTTCTTGTCACATGGCCAGG - Intronic
1050888194 9:10791130-10791152 CAAGTTCTTGTTCCAAGTCCAGG - Intergenic
1050913145 9:11100311-11100333 CAGGTTCTGGTCTCACAACCAGG + Intergenic
1050929858 9:11309001-11309023 CGGGTTCTTGTCACATGACCAGG - Intergenic
1050947998 9:11550213-11550235 CAAGTTCTTGTCCCAAATCCAGG - Intergenic
1051134333 9:13901148-13901170 CCTGTTCTTGTCTCATGCCCAGG - Intergenic
1052059238 9:23940999-23941021 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1052059864 9:23946514-23946536 TGAGTTCCTGTCTCATGACCAGG + Intergenic
1052116059 9:24649495-24649517 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1052158619 9:25226781-25226803 CAAGTTCTTGTCCCACATCCAGG + Intergenic
1052509032 9:29390750-29390772 TGGGTTCTTGTCACATGACCAGG + Intergenic
1052519920 9:29533668-29533690 CAGGTTGTTGTCACAGGACCAGG + Intergenic
1052609807 9:30758336-30758358 CAAGTTTTTGTACCATGTCCAGG + Intergenic
1052623571 9:30944708-30944730 CAAGTTCTTGTCCCACGTCGCGG - Intergenic
1052875622 9:33560147-33560169 TGGGTTCTTCTCTCATGACCAGG + Intronic
1053500389 9:38584197-38584219 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1053911107 9:42905032-42905054 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1054361739 9:64128590-64128612 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1054372853 9:64421903-64421925 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1054680480 9:67911680-67911702 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1055202507 9:73684163-73684185 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1055803656 9:80068791-80068813 TGGGTTCTTGTTTCATGACCAGG + Intergenic
1055890856 9:81122320-81122342 CAAGTTCTTATCTCATGTTCAGG + Intergenic
1056350549 9:85744477-85744499 CAGGTTCTTGTCTCAAGACCAGG + Intergenic
1056462212 9:86818853-86818875 CAAGTTTTTGTCCCGTGTCCAGG - Intergenic
1056570266 9:87808554-87808576 CAGGTACTTGTCTCATGACCAGG - Intergenic
1056994392 9:91442946-91442968 CAAGTTCTTGTCCCACATCCAGG + Intergenic
1057174751 9:92988055-92988077 CGGGTTCTTGTCTCATTACCAGG + Intronic
1057342426 9:94214601-94214623 CAGGTTCTTGTCACACGACCAGG - Intergenic
1057468621 9:95338194-95338216 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1057679786 9:97168623-97168645 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1058047794 9:100375669-100375691 AGGTTTCTTGTCTCATGACCAGG + Intergenic
1058172812 9:101703293-101703315 CTAGTTCCTGTCTCATACCCTGG + Intronic
1058801655 9:108550313-108550335 CAAGTTCTTGTGTCATCATACGG + Intergenic
1059190942 9:112325510-112325532 CAGGTTCTTGTCTCACAACCAGG - Intronic
1059383840 9:113949061-113949083 CAAGATCTGGACTGATGACCGGG - Intronic
1060043666 9:120323595-120323617 CAATTCCTTGTCAGATGACCAGG - Intergenic
1060486916 9:124053629-124053651 CAGGGTCTTGTCTCATGACCAGG - Intergenic
1062702645 9:137915792-137915814 CTTTTTCTTGTCTCATGACCTGG - Intronic
1203706434 Un_KI270742v1:53059-53081 TGTGTTCTTCTCTCATGACCAGG + Intergenic
1185722851 X:2395775-2395797 CAAGTTCTTGTCCCATGACCTGG + Intronic
1185951900 X:4446558-4446580 TAAGTTATTATCTCAAGACCTGG - Intergenic
1186223573 X:7374863-7374885 CAAGTTTTTGTCTCGTCTCCAGG + Intergenic
1186762670 X:12739721-12739743 CAATTTCTTGTCACACCACCAGG + Intergenic
1187842891 X:23506952-23506974 CGGGCTCTTGTCACATGACCAGG - Intergenic
1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG + Intergenic
1188194986 X:27222464-27222486 CGAGTTCTTGTCCAATGTCCAGG - Intergenic
1188254915 X:27950025-27950047 CAATCTCTGATCTCATGACCTGG + Intergenic
1188375271 X:29421166-29421188 CAGGTTCTTGTCACATGACCAGG + Intronic
1188647934 X:32592611-32592633 TGAGTTCTTGTCCCATGTCCAGG - Intronic
1188859798 X:35243601-35243623 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
1189083648 X:37998198-37998220 TGAGTTCTTGTCTTGTGACCAGG - Intronic
1189117281 X:38356392-38356414 TGAGTTCTTTTCACATGACCAGG + Intronic
1189649800 X:43177114-43177136 CAGGTTCTTGTCACAGGACCAGG - Intergenic
1189947767 X:46196475-46196497 CAGGTTCTTGTCTCACAACCAGG - Intergenic
1190360507 X:49644594-49644616 CGAGTTCTTGTCTTGTGTCCAGG + Intergenic
1190620630 X:52284105-52284127 CAAGTTCTTGTCTTGTGTCCAGG + Intergenic
1190621246 X:52288713-52288735 TGAGTTCTTGTCCCATGTCCAGG - Intergenic
1191697163 X:64001982-64002004 TAAATTCCTGTCTCATTACCTGG - Intergenic
1191846091 X:65549359-65549381 CCAGTTCTTGTCTCCCGTCCTGG - Intergenic
1192089741 X:68141022-68141044 CAAGTTCTTGTTTGGTGTCCAGG - Intronic
1192950790 X:76014241-76014263 CAAATCCTTCTCTCATGACCTGG - Intergenic
1193140545 X:78022165-78022187 CAGATTCTTGTCACACGACCAGG - Intronic
1193211396 X:78810847-78810869 TGAGTTCTTGTCCCATGTCCAGG + Intergenic
1193269877 X:79516258-79516280 TGGGTTCTTGTCACATGACCAGG - Intergenic
1193574972 X:83185577-83185599 CAAGTACTTGTCCTGTGACCAGG + Intergenic
1193699968 X:84748236-84748258 CGGGTTCTTGTCACACGACCAGG - Intergenic
1194059231 X:89177251-89177273 CGGGATCTTGTCTCATCACCAGG + Intergenic
1194088872 X:89562083-89562105 CAAGTTCTTGTGACACGACCAGG + Intergenic
1194160487 X:90444172-90444194 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1194227608 X:91280267-91280289 CAGGTTCTTGTCTTATGACCAGG + Intergenic
1194476013 X:94360795-94360817 CAGGTTCTTGTCTCATGACTAGG + Intergenic
1194640981 X:96404150-96404172 CAGGTTCTTGTCACACGACCAGG + Intergenic
1194653082 X:96538636-96538658 CCGGTTCTTGTCACACGACCAGG - Intergenic
1194680264 X:96843557-96843579 TGGGTTCTTGTCACATGACCAGG + Intronic
1195349139 X:103980361-103980383 CAACTTCTTGCCTGATGGCCTGG - Intergenic
1195352581 X:104009108-104009130 CAACTTCTTGTCTGATGGCCTGG + Intergenic
1195356514 X:104044454-104044476 CAACTTCTTGTCTGATGGCCTGG - Intergenic
1195358304 X:104058478-104058500 CAACTTCTTGCCTGATGGCCTGG + Intergenic
1195582121 X:106517200-106517222 AAAGTTTATGTCTCATGACTAGG - Intergenic
1196478114 X:116112478-116112500 CAAATTCTTCTCTCGTGATCTGG + Intergenic
1196599588 X:117586059-117586081 TAAGGTCTTCTCCCATGACCTGG + Intergenic
1196691516 X:118563923-118563945 CCAGTTCTTGTCACATAACCAGG + Intronic
1197035730 X:121870924-121870946 CAAGTTCTTGTCCCATATCCAGG - Intergenic
1197066706 X:122241940-122241962 TGGGTTCTTGTCTCATGGCCAGG + Intergenic
1197299458 X:124760264-124760286 CAGGTTCTTGTCACACGACCAGG - Intronic
1197300845 X:124778434-124778456 CAGATTCTTGTCACATGACCAGG - Intronic
1197509827 X:127356725-127356747 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1197971308 X:132118331-132118353 CAGGTTCTTGTCACACGACCAGG + Intronic
1198043590 X:132878108-132878130 CAGGTTCTCGTCTCATGACTAGG + Intronic
1198139317 X:133786826-133786848 TGGGTTCTTGTCACATGACCAGG - Intronic
1198363035 X:135914695-135914717 CAAGTTCTTGTCACACGACCAGG + Intergenic
1199092391 X:143706528-143706550 CAAGTTCTTGTCCTGTGTCCAGG - Intergenic
1199570126 X:149259027-149259049 CAAGTTTTTGACTAATGAGCAGG + Intergenic
1199614854 X:149648230-149648252 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1199829818 X:151538389-151538411 CAAGTTCTTGTCACATGACCAGG + Intergenic
1200258342 X:154597798-154597820 TGGGTTCTTGTCACATGACCAGG - Intergenic
1200441548 Y:3218135-3218157 CAAGTTCTTGTGACACGACCAGG + Intergenic
1200506777 Y:4021112-4021134 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1200852117 Y:7894002-7894024 CAGGATCTTGTCACATGATCAGG - Intergenic
1200972203 Y:9164646-9164668 TGAGTCCTTGTCTCATGTCCAGG - Intergenic
1201221297 Y:11773403-11773425 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1201319138 Y:12678007-12678029 TGGTTTCTTGTCTCATGACCAGG + Intergenic