ID: 1177884704

View in Genome Browser
Species Human (GRCh38)
Location 21:26733624-26733646
Sequence TTCCACCTGGACCATGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177884699_1177884704 5 Left 1177884699 21:26733596-26733618 CCCCTTCACACTCTGGAGGCTCA No data
Right 1177884704 21:26733624-26733646 TTCCACCTGGACCATGGTATAGG No data
1177884700_1177884704 4 Left 1177884700 21:26733597-26733619 CCCTTCACACTCTGGAGGCTCAC No data
Right 1177884704 21:26733624-26733646 TTCCACCTGGACCATGGTATAGG No data
1177884698_1177884704 6 Left 1177884698 21:26733595-26733617 CCCCCTTCACACTCTGGAGGCTC No data
Right 1177884704 21:26733624-26733646 TTCCACCTGGACCATGGTATAGG No data
1177884701_1177884704 3 Left 1177884701 21:26733598-26733620 CCTTCACACTCTGGAGGCTCACA No data
Right 1177884704 21:26733624-26733646 TTCCACCTGGACCATGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177884704 Original CRISPR TTCCACCTGGACCATGGTAT AGG Intergenic
No off target data available for this crispr