ID: 1177887041

View in Genome Browser
Species Human (GRCh38)
Location 21:26759868-26759890
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177887041_1177887043 9 Left 1177887041 21:26759868-26759890 CCCAGAGCTTTAGAATCATTAAC No data
Right 1177887043 21:26759900-26759922 AGATTCACAATACTTATCAGTGG No data
1177887041_1177887044 10 Left 1177887041 21:26759868-26759890 CCCAGAGCTTTAGAATCATTAAC No data
Right 1177887044 21:26759901-26759923 GATTCACAATACTTATCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177887041 Original CRISPR GTTAATGATTCTAAAGCTCT GGG (reversed) Intergenic
No off target data available for this crispr