ID: 1177893350

View in Genome Browser
Species Human (GRCh38)
Location 21:26833379-26833401
Sequence GCTGCTTGTACTCACAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177893346_1177893350 -2 Left 1177893346 21:26833358-26833380 CCTCTGATCACCACTGGGGCTGC No data
Right 1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG No data
1177893340_1177893350 18 Left 1177893340 21:26833338-26833360 CCCAGCAGGCAGGGAGTTGCCCT No data
Right 1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG No data
1177893341_1177893350 17 Left 1177893341 21:26833339-26833361 CCAGCAGGCAGGGAGTTGCCCTC No data
Right 1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG No data
1177893345_1177893350 -1 Left 1177893345 21:26833357-26833379 CCCTCTGATCACCACTGGGGCTG No data
Right 1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG No data
1177893339_1177893350 19 Left 1177893339 21:26833337-26833359 CCCCAGCAGGCAGGGAGTTGCCC No data
Right 1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177893350 Original CRISPR GCTGCTTGTACTCACAAGTG GGG Intergenic
No off target data available for this crispr