ID: 1177893686

View in Genome Browser
Species Human (GRCh38)
Location 21:26836787-26836809
Sequence TAGGAAAGAAAGGAAGTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 953
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 850}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177893681_1177893686 -3 Left 1177893681 21:26836767-26836789 CCCAAAGCAGGGTTACATGGTAG 0: 1
1: 0
2: 1
3: 12
4: 71
Right 1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG 0: 1
1: 0
2: 5
3: 97
4: 850
1177893682_1177893686 -4 Left 1177893682 21:26836768-26836790 CCAAAGCAGGGTTACATGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG 0: 1
1: 0
2: 5
3: 97
4: 850
1177893679_1177893686 4 Left 1177893679 21:26836760-26836782 CCATATTCCCAAAGCAGGGTTAC 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG 0: 1
1: 0
2: 5
3: 97
4: 850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177893686 Original CRISPR TAGGAAAGAAAGGAAGTTGG AGG Exonic
900547528 1:3236975-3236997 TAGCAAAGGGAGGAAGCTGGGGG + Intronic
900580214 1:3405044-3405066 TAGGAAGGAAAGGAAGTCTCAGG + Intronic
900717020 1:4151786-4151808 AAAGAAAGAAAAGAAATTGGAGG - Intergenic
900892337 1:5458479-5458501 AAGGAAAGAAAGAAAGAAGGAGG - Intergenic
901223530 1:7597649-7597671 CAGGAAAGAAATGATGTTGTAGG + Intronic
901421127 1:9151860-9151882 GAGGAAAGAAAGGATGCAGGAGG + Intergenic
901469287 1:9444469-9444491 TATGAAAGAATGAAAATTGGTGG - Intergenic
901638404 1:10680886-10680908 AAAGAAAGAAAGAAAGATGGGGG - Intronic
901876291 1:12168678-12168700 CAGGAAGGGAAGGAAGTGGGAGG - Intronic
902740235 1:18432825-18432847 AAGGAAGGAAAGGAAGTTTCTGG - Intergenic
902949615 1:19872016-19872038 GAGAAAAGAGAGGAAGTTGTTGG + Intergenic
903544173 1:24113212-24113234 AAGGAAAGGAAGGAACGTGGGGG - Intergenic
903638272 1:24835626-24835648 TAGGACAGAAAGGAGGTTAATGG + Intronic
903705819 1:25284995-25285017 CAGGAAAGAAAGGATGCAGGAGG - Intronic
903721419 1:25408424-25408446 CAGGAAAGAAAGGATGCAGGAGG + Intronic
903923255 1:26816251-26816273 AAGGAAAGAAAGGAAGGAAGAGG + Intergenic
905145664 1:35884935-35884957 TAGGAAAGTAATGAAGTTCATGG - Intronic
905260718 1:36716227-36716249 GAGGACAGAAATGAGGTTGGAGG - Intergenic
905362039 1:37427582-37427604 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
905970188 1:42135976-42135998 TAGAACAGAAAGGAAGAAGGTGG - Intergenic
906637819 1:47421384-47421406 TAGGGAAGCAGGGAAGGTGGTGG + Intergenic
906732126 1:48091866-48091888 AAGGAGAGAACAGAAGTTGGAGG + Intergenic
906850933 1:49250062-49250084 GAGGCCAGTAAGGAAGTTGGAGG + Intronic
907080831 1:51620233-51620255 TATGGAAGGAAGGAAATTGGGGG + Intronic
907218109 1:52883766-52883788 TAGGAAAAAAAGCAACTTGCAGG - Intronic
907335454 1:53696636-53696658 AAGGAGAGAAATAAAGTTGGAGG - Intronic
907636985 1:56145237-56145259 GAGGAAAGAAGGGAAGTTATTGG + Intergenic
907809678 1:57856172-57856194 TAGAAAAGAGAAGAAGCTGGGGG + Intronic
908418299 1:63934516-63934538 TAGGAAATAAATGAAGTTGAGGG - Intronic
908529560 1:65021379-65021401 AAGGAAAGAACAGAAGTGGGAGG - Intergenic
908578489 1:65488076-65488098 AAGGAAAGAAAGGAAGAGAGAGG - Intronic
908742579 1:67343578-67343600 GAGAAGAGAAAGGAAGTTTGAGG - Intronic
909265007 1:73546747-73546769 TAAGAAAGAAAGGAGGTTAAAGG + Intergenic
909437451 1:75659402-75659424 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
909554451 1:76937976-76937998 TAGGGAAGAAAAGAACTTAGAGG + Intronic
909644678 1:77903922-77903944 CAAGAAAGAAAGGAAGTGGGAGG + Intronic
909752137 1:79175732-79175754 TAAGAAGGAAAGGAATTTAGGGG - Intergenic
910328411 1:86039000-86039022 TATGAAACAAATTAAGTTGGTGG - Intronic
910430838 1:87158316-87158338 AGGGAAAGGAAGGAAGATGGAGG - Intronic
910666678 1:89732725-89732747 TGGGAAATACAGGAAGTGGGTGG + Intronic
911592562 1:99765254-99765276 TGGGATAGAACTGAAGTTGGGGG - Intronic
913342318 1:117770943-117770965 TAGGAAGGAAGGAAAGTGGGAGG - Intergenic
913496551 1:119433174-119433196 TAGGAAGGATAGGAGGGTGGTGG + Intergenic
913513095 1:119580482-119580504 TAGGAACCAAAGGAAGGTGGTGG + Intergenic
914235133 1:145802353-145802375 TAGGAAGGAAAGGAAAAGGGTGG + Intronic
915577491 1:156789571-156789593 GAGGAAAGAAGGGAATCTGGAGG + Intronic
915972137 1:160362497-160362519 AAGGAAACTAAGGAAGTAGGGGG + Intergenic
917257960 1:173136610-173136632 AAGGAAAGGAAGGAATTTGCAGG + Intergenic
917501061 1:175585748-175585770 AAGGAAGGGAAGGAAGTGGGAGG - Intronic
917931254 1:179824341-179824363 CAGGATAGAGAGGAAGTGGGAGG - Intergenic
918431405 1:184464661-184464683 TAGGAAAGAGAGCAAATTGAAGG + Intronic
918476579 1:184931530-184931552 AAGCATAGAAATGAAGTTGGAGG + Intronic
918540231 1:185624135-185624157 TAGAAAAGAAATGATTTTGGGGG + Intergenic
918611786 1:186500637-186500659 AGGGAAAGAAAGGAAGTGTGAGG + Intergenic
918868108 1:189929994-189930016 TAGAAAAGAAATGATTTTGGGGG + Intergenic
919827896 1:201516807-201516829 AAGGAAAGAAAGGAGGGAGGGGG + Intergenic
920072291 1:203311150-203311172 GAGGTAAGAAATGAAGTTGGGGG - Intergenic
920251970 1:204627934-204627956 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
920353008 1:205350208-205350230 TTGGAGAGAAAGGAGGGTGGTGG - Intronic
920694767 1:208174027-208174049 TTGAAAAGAAGAGAAGTTGGTGG + Intronic
920702617 1:208229206-208229228 GAGGAGAGAAAGGAGATTGGAGG + Intronic
920851764 1:209632820-209632842 AAATAAAGAAAGGAAGTTAGAGG + Intronic
921179633 1:212621790-212621812 TTAGAGAGGAAGGAAGTTGGGGG + Intergenic
921253813 1:213321754-213321776 GAGGAAAGACAGGAAGTGAGAGG + Intergenic
921861381 1:220045918-220045940 GAGGTAAGAAAAGGAGTTGGGGG + Intronic
922195984 1:223361186-223361208 TAGGAAAGAAATGCACATGGAGG - Intronic
922351824 1:224740401-224740423 TAGAAAAGAAAAGAAGTTTGGGG - Exonic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
922793948 1:228329088-228329110 TTGAAAAAGAAGGAAGTTGGAGG - Intronic
923021345 1:230166694-230166716 GAAGAAAGCAAGGAAGTTGGGGG - Intronic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923159815 1:231306357-231306379 TAGGAAAGTAAGGCAGAAGGTGG - Intergenic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923477394 1:234346868-234346890 TTGGAAAGACAGGAAGTATGTGG - Intergenic
923891288 1:238217718-238217740 TGAGAAAGGAAGCAAGTTGGGGG + Intergenic
924017698 1:239745052-239745074 GAGGCAAGAAAGGGAGTGGGAGG + Intronic
924895381 1:248332950-248332972 AAGGAAAGAAAGGAATTGTGTGG - Intergenic
1062960373 10:1568620-1568642 AAGGAAGGAAAGAAAGCTGGAGG + Intronic
1063365356 10:5487133-5487155 TAGGACAGGAGGGAAGGTGGAGG - Intergenic
1063689845 10:8276317-8276339 TAGAAAAGAAAATAATTTGGGGG + Intergenic
1063716867 10:8536230-8536252 TAGGAAAGACAAGCTGTTGGGGG - Intergenic
1063796115 10:9515735-9515757 GAGGAAAGAAAGGAAGGAGAAGG + Intergenic
1063804322 10:9620805-9620827 TAGGAAAGAAAATGATTTGGTGG - Intergenic
1064338977 10:14469770-14469792 TAGAAAAGAAATGATTTTGGGGG - Intergenic
1064393353 10:14959927-14959949 TATGGCAGAAAGGAAGCTGGAGG + Intronic
1066086568 10:31977557-31977579 TTAGAAATACAGGAAGTTGGTGG - Intergenic
1066362556 10:34745371-34745393 TAGAAAAGAAAGGAAGTAAAAGG + Intronic
1066487035 10:35856117-35856139 AAGGAAAGAAAGGAAGAGAGAGG - Intergenic
1066600800 10:37104923-37104945 TAGGAAAGAGAGAAAGTTATGGG + Intergenic
1067002486 10:42630076-42630098 CAGGAAAGAAAGAAGATTGGAGG - Intronic
1067286305 10:44909982-44910004 GAGGAAAGAAAGGAAGGGGAAGG + Intergenic
1067467685 10:46513310-46513332 TAGCAAGGGAAGGAAGTAGGAGG - Intergenic
1067619501 10:47871295-47871317 TAGCAAGGGAAGGAAGTAGGAGG + Intergenic
1068446109 10:57125818-57125840 TAGGAAAGAAAAGAAGGTGAGGG - Intergenic
1068601376 10:58960623-58960645 TAGAAAAGAAAATAATTTGGGGG - Intergenic
1068683606 10:59846419-59846441 GAGGACAGGAAGGAAGTTGTGGG - Intronic
1068737350 10:60429317-60429339 TAAGAAAGAAAGGAAGTAAAAGG + Intronic
1069256604 10:66339605-66339627 TAGAAATAAAAGGAATTTGGGGG - Intronic
1069335938 10:67350343-67350365 TAGGAGAGAAAGATAGTTGGAGG + Intronic
1069848898 10:71392353-71392375 TAGGAACAAAAGGAGGCTGGTGG + Intergenic
1070106782 10:73440569-73440591 TAGAATAGAAAGGAAGTTACTGG - Intronic
1070163682 10:73881818-73881840 AAGGAGAGGAAGGATGTTGGTGG + Intergenic
1070513822 10:77185241-77185263 TATGAAATTAAGGAATTTGGAGG - Intronic
1071157324 10:82706081-82706103 AAGAAAAGAAAGGGAGTGGGTGG - Intronic
1071182383 10:83002042-83002064 TGGGTAGGAATGGAAGTTGGGGG + Intergenic
1071396992 10:85233895-85233917 AAGGAAACAGAGGAACTTGGGGG - Intergenic
1071430007 10:85599969-85599991 GAGGAAAGAGAGGGAGATGGAGG - Exonic
1071867760 10:89755518-89755540 AAGGAAGGAAAGGAAGAAGGAGG - Intronic
1072275883 10:93822660-93822682 GAGGAAAAAAACAAAGTTGGAGG + Intergenic
1072491518 10:95910446-95910468 GAGGAAATAAAGGAAGGAGGGGG + Intronic
1072681998 10:97514374-97514396 TGGAAAAGAGAGGAATTTGGGGG - Intronic
1072761927 10:98063747-98063769 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1072961192 10:99930721-99930743 TAGAAAAGAAAGGGAAGTGGAGG - Intronic
1073068133 10:100776166-100776188 GAGGAAAGTATGGAAGGTGGAGG - Intronic
1073439681 10:103545078-103545100 AAGGGAAGAAAGGAAGGCGGCGG + Intronic
1073509313 10:104033507-104033529 TGGAATACAAAGGAAGTTGGAGG - Intronic
1074234924 10:111575631-111575653 TAGAAAATATAGGAAGTTTGTGG + Intergenic
1074244837 10:111678998-111679020 TAGGAAAGAAAGGACATTCTGGG - Intergenic
1074542280 10:114374812-114374834 TAGGAAGGAATGGAGGATGGGGG + Intronic
1074864330 10:117536129-117536151 GAGGAAAAAAAGGAAACTGGAGG - Intergenic
1075398875 10:122147440-122147462 GGGGAAAAAAAGGAACTTGGCGG - Intronic
1075507032 10:123032887-123032909 GGGGAAAGAATGGAAATTGGAGG - Intronic
1075978277 10:126715721-126715743 TAGAAAAGAAATGATTTTGGGGG - Intergenic
1076331193 10:129669328-129669350 CAGGAAAAAAAGGAAATTAGAGG - Intronic
1077876155 11:6308359-6308381 TAGTAGAGAAAGGAAGATTGAGG - Intergenic
1078011819 11:7578213-7578235 AAGGAATGAACGGACGTTGGGGG + Intronic
1078159393 11:8827893-8827915 TAGTAGAGGAAGGAAGTTTGTGG - Intronic
1078376175 11:10795016-10795038 TAGGTAAGAAATGAGGGTGGTGG + Intergenic
1078475369 11:11624591-11624613 TTGCAAACAAAGGAAGTGGGAGG + Intergenic
1079199710 11:18365584-18365606 AAGGAAAGACAGAAAGTAGGGGG - Intronic
1079320224 11:19445775-19445797 TAAGAGAGAAAGGGAGATGGAGG + Intronic
1080050805 11:27857130-27857152 TGGAAAAGGAAGGAAGGTGGGGG - Intergenic
1080347792 11:31344318-31344340 TAGGAAGTAAAGGAAGATTGTGG - Intronic
1080413899 11:32051793-32051815 AAGGAAAGAAAGGAAGGAGAAGG + Intronic
1080476268 11:32594437-32594459 TTGGTAAAAAGGGAAGTTGGTGG + Intronic
1080559686 11:33451663-33451685 GAGTAAAGAAAGGAGGTTGAGGG - Intergenic
1080576100 11:33600546-33600568 AAGGAAAGGAAGGAAGGAGGGGG - Intronic
1081367423 11:42253039-42253061 TAGGTAAGAGAAGGAGTTGGGGG - Intergenic
1081442380 11:43094336-43094358 TAGGAGAGAAAAGAATTTTGGGG + Intergenic
1081530445 11:43955009-43955031 TAGGAAAGAAATGATTTTGGGGG + Intergenic
1081708681 11:45202675-45202697 AAGGAAAGAGAAGAAGTTGGAGG + Intronic
1081780305 11:45706066-45706088 TAGGAAAGACAGGATGTCTGTGG + Intergenic
1081936279 11:46906007-46906029 AAGGACAGAGAGGAAGTAGGGGG + Intronic
1082054033 11:47798079-47798101 AAGGAAAGAAAGGAATATGAGGG + Intronic
1082223064 11:49665665-49665687 GAGGAAACAAATGAAGGTGGAGG + Intergenic
1083840907 11:65303804-65303826 TTGGAAAGAAAAGAGGTGGGAGG + Intronic
1084051091 11:66600465-66600487 TAAGAAAGAAAGGAAACAGGTGG - Intronic
1084280228 11:68085054-68085076 AAGGAAAGAAAGAAGGTGGGAGG - Intronic
1084280230 11:68085058-68085080 TAGGAAGGAAAGAAAGAAGGTGG - Intronic
1084359413 11:68659926-68659948 AAAGAAAAAAAAGAAGTTGGAGG - Intergenic
1084964508 11:72737540-72737562 TAGGGAAAGAAGGAAGCTGGAGG - Intronic
1085100910 11:73799011-73799033 AAGAAAAGAAAGGAAGGTAGTGG + Intronic
1085201752 11:74706220-74706242 GAGGAAAGTGAGGAAGTTTGGGG + Intronic
1085303597 11:75472912-75472934 GAGGAGAGAAAGGAAGGAGGAGG + Intronic
1085520547 11:77136732-77136754 GAGGAAAGAAAGGAACATAGAGG + Intronic
1086124659 11:83338026-83338048 TAGGATAGAATGGCAGATGGAGG - Intergenic
1086486026 11:87303048-87303070 TAGGCAATAAAGAAAGTTAGGGG + Intronic
1086625987 11:88953567-88953589 GAGGAAACAAATGAAGGTGGAGG - Intronic
1087161118 11:94949076-94949098 AAGGAAAGGAAGGAAGTGAGAGG + Intergenic
1087552702 11:99672269-99672291 TAGGGAAGAAAGGAAGCAGAAGG + Intronic
1087762041 11:102111435-102111457 GAAGAAAGAAAGGAAGAAGGAGG - Intronic
1087815875 11:102658147-102658169 TAGGGAAGAAAGGAGGTGGAGGG + Intergenic
1087938814 11:104068281-104068303 CAAGAAACAAAGGAATTTGGTGG - Intronic
1088036624 11:105324919-105324941 GAGGAAAGAAAGCAAGTTTCTGG + Intergenic
1088620082 11:111672595-111672617 TAGAAGAGGAAGGAAGATGGTGG + Intronic
1088634036 11:111802111-111802133 TTGGTAAGGAGGGAAGTTGGGGG - Intronic
1088804341 11:113338380-113338402 TAGGAAATAAATGAAGCTAGAGG - Intronic
1088959314 11:114646086-114646108 TAAGAAATAAAAGAAGTTGAAGG - Intergenic
1088999256 11:115036793-115036815 CAGTGAAGAAAGAAAGTTGGAGG - Intergenic
1089021027 11:115215131-115215153 TAGGAAAGAAATCAAGTTCTTGG + Intronic
1089521380 11:119066590-119066612 AAGAAAAAAAAGGAAGTTGGGGG + Intergenic
1089945719 11:122471193-122471215 TAGGAAAGAAATACAATTGGAGG - Intergenic
1090538875 11:127678483-127678505 TAGGAAAGAAGGAAAGTTGGCGG - Intergenic
1091028368 11:132161622-132161644 GAGGAAGCAAAGAAAGTTGGGGG - Intronic
1091521368 12:1247248-1247270 CCGGAAAGAAAGGACATTGGTGG + Intronic
1092203804 12:6603512-6603534 TAGGACAGACAGGAAGTGGCAGG + Intronic
1092814631 12:12302077-12302099 CAGGAAAATAAAGAAGTTGGTGG + Intergenic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1094218274 12:27969085-27969107 TGGAAAAGAAAAAAAGTTGGGGG - Intronic
1094604681 12:31940162-31940184 AAGAAAAGAAAAGAAGTAGGTGG + Intergenic
1094637339 12:32239264-32239286 AAGAAAAGAAAGGAAATTGTTGG + Intronic
1095417810 12:41995194-41995216 AAGGAAAGAAAGGGAGAGGGAGG + Intergenic
1096138784 12:49225211-49225233 CTGGAAAAAAAGGAAGTTTGGGG - Intronic
1096339354 12:50784342-50784364 TAGGAGAGATAGGGAGTTGGTGG + Intronic
1096413550 12:51393754-51393776 TGTGAAAGGAAGGGAGTTGGTGG - Intronic
1096488558 12:52000661-52000683 TAAGAGAGACAGGAGGTTGGGGG + Intergenic
1096745439 12:53723921-53723943 TGGGAAAGAAAGGAAGGAGAGGG - Intronic
1096787439 12:54025510-54025532 CAGGAATGAAAGGTAATTGGGGG + Intronic
1096840847 12:54378672-54378694 TAGGAAAGAGAGGGAGCTAGGGG + Intronic
1096979338 12:55719367-55719389 AAAGAAAGAAAAGCAGTTGGTGG + Intronic
1096989129 12:55784523-55784545 TATGAAAGGAGAGAAGTTGGAGG - Intronic
1097170375 12:57109665-57109687 TAGAAGAGAGAGGAAGCTGGAGG + Intronic
1097333455 12:58356768-58356790 AAGGCAAGAAATTAAGTTGGTGG + Intergenic
1097373746 12:58816005-58816027 AAGGAAAGGAAGAAAGTTGAAGG - Intergenic
1097639839 12:62167205-62167227 AAAGAAAGAAAGGAAGATGAAGG + Intronic
1097642256 12:62196556-62196578 CAGGAGAGAGAGGGAGTTGGGGG + Intronic
1098014519 12:66090342-66090364 TGGCAGAGAAAGGAAGTTGAAGG + Intergenic
1098375664 12:69810905-69810927 TGGGAAAAAAATGGAGTTGGAGG + Intronic
1098713446 12:73798443-73798465 TAGGAGATGAAGGATGTTGGTGG + Intergenic
1099186075 12:79516608-79516630 TAGGAAAAAAAGTAACTTAGTGG + Intergenic
1099319349 12:81125508-81125530 CAGGAAAGAAAGGAAAATGAGGG - Intronic
1099332803 12:81311758-81311780 AAAGAAAGAAAGAAAGGTGGAGG + Intronic
1101103654 12:101419674-101419696 TAGGAAATGAACAAAGTTGGAGG - Intergenic
1101455251 12:104824931-104824953 CAGGAAAGAGAGAAAGGTGGTGG - Intronic
1101822196 12:108192651-108192673 TAAGAAACAAAGGAGCTTGGGGG - Intronic
1102859741 12:116325435-116325457 TTGGAAAGACAGGAAGCAGGTGG + Intergenic
1102959320 12:117081914-117081936 AAAAAAAGAAAAGAAGTTGGGGG + Intronic
1103094315 12:118120601-118120623 GAGGGAAAAAAGGAATTTGGGGG + Intronic
1103144771 12:118585607-118585629 TAAGAAATAAAGCAACTTGGAGG + Intergenic
1103229141 12:119313480-119313502 GGGGAAAGAAAGGGAGTTGGAGG - Intergenic
1103274609 12:119701172-119701194 CAGGAAAGAAGGGAAGGGGGAGG + Intronic
1103308199 12:119983057-119983079 TAGGAAAGGATAGAAGCTGGAGG + Intergenic
1103367013 12:120390765-120390787 GAGGGAAGAAAGGAAGGAGGAGG + Intergenic
1103412800 12:120724867-120724889 TGGGAAAGAAAGGCAGTTGGAGG + Intergenic
1103464222 12:121129006-121129028 GAGGAAAGAAAGGAAGATGGCGG - Intergenic
1103617293 12:122162434-122162456 AAGGAAGGAAAGGAGGTTGGGGG - Intergenic
1104537073 12:129628263-129628285 TTAGAAAGAAAAGAAATTGGTGG + Intronic
1105490364 13:20882395-20882417 CAAGAAAGAAAGCAAGTGGGGGG + Intronic
1106600065 13:31180120-31180142 AAAGAAAGAAAGAAAGTTGGTGG - Intergenic
1107117897 13:36766719-36766741 GAGGAAATAATGGAAGGTGGAGG + Intergenic
1107425901 13:40292662-40292684 CAGGTAAGGAAGGAACTTGGGGG + Intergenic
1107629018 13:42324230-42324252 TAGGACAGAGAGGAAGGTGAGGG + Intergenic
1108557853 13:51613277-51613299 TGGGAAAGAAGGGGAGATGGGGG - Intronic
1108641302 13:52384888-52384910 TATGAAAGACAGGCAGATGGAGG + Intronic
1109660937 13:65459149-65459171 TAGAAAAGAAAGTGATTTGGAGG + Intergenic
1110024531 13:70518733-70518755 TAAGAAAGAAAGAAAGAAGGAGG + Intergenic
1110200008 13:72838833-72838855 AAGGAAGGAAAGGAAATTGGGGG + Intronic
1110682739 13:78335378-78335400 TAGGAAAGAAAGAATATTCGAGG - Intergenic
1110910101 13:80949105-80949127 GAGGAAAGACAGAAAGTGGGTGG + Intergenic
1110963447 13:81659925-81659947 TAAGAAAAAAAAGAATTTGGAGG + Intergenic
1111239474 13:85456146-85456168 TAGGCAAGAGGAGAAGTTGGTGG - Intergenic
1111579209 13:90200874-90200896 AAGGAAAGAAAGGGAGTTGGGGG - Intergenic
1111629476 13:90831557-90831579 TGGGATAGAGAGGGAGTTGGGGG - Intergenic
1111974297 13:94949735-94949757 TAGAAAAGAAAAGAAGTTTAGGG + Intergenic
1112542084 13:100324194-100324216 CAGGAATGAAAGCAAGTGGGAGG - Intronic
1112816394 13:103278660-103278682 TTGCAGAGAATGGAAGTTGGGGG - Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113255426 13:108500010-108500032 CAGGAAAGAAAGGAAGAGAGGGG - Intergenic
1113356113 13:109581770-109581792 AAGGACAGAAAGAAAGTTTGTGG - Intergenic
1113600911 13:111567638-111567660 AAGGAGAGAGAGGAAGTTAGTGG + Intergenic
1113808844 13:113125121-113125143 TGGGAAAGACATGAATTTGGAGG + Intronic
1113812474 13:113150941-113150963 CAGGATAGAAAGGAAACTGGAGG + Intergenic
1115016225 14:28617519-28617541 TTGTAAGTAAAGGAAGTTGGTGG + Intergenic
1115320414 14:32075090-32075112 AAGGAGAGAAGGGAATTTGGTGG - Intergenic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1115659148 14:35474732-35474754 TAAAAAAAAAAGGTAGTTGGTGG + Intergenic
1116478997 14:45375141-45375163 TGAGAAAGGAAGGAGGTTGGTGG + Intergenic
1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG + Intronic
1117854370 14:60011814-60011836 TAGGAAGAAAAGCAATTTGGGGG + Intronic
1118272321 14:64354988-64355010 TAAGAAAGAAAGAAAGCGGGCGG - Intergenic
1118503150 14:66382272-66382294 TAGGAAAAGAAGGAAGAAGGAGG - Intergenic
1118757854 14:68858271-68858293 TAGGATATAAAGGAAATTGTAGG - Intergenic
1119433756 14:74584836-74584858 GAGCAAAGAAAGGAGGTTGAGGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120286707 14:82511571-82511593 TAGAGAAGAAAGGCAGATGGTGG - Intergenic
1120628880 14:86864563-86864585 AAAGAAAGAAAGGAAATTGTAGG - Intergenic
1120772063 14:88389858-88389880 TAGAATAGAATGGAATTTGGAGG + Intronic
1121091293 14:91184560-91184582 AAAGAAAGAAAGAAAGTTGGGGG + Intronic
1121334885 14:93071152-93071174 CAGGCAGGAAAGGAAGTTGCAGG - Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121592586 14:95128065-95128087 TAGAAATGAATGAAAGTTGGGGG - Intronic
1121800274 14:96768929-96768951 AAGGAAAGAAAGAAAGAAGGAGG - Intergenic
1122293188 14:100690475-100690497 AAAGAAAGAAAGAAAGTAGGCGG - Intergenic
1122362253 14:101174408-101174430 TTGGAAAAAAGTGAAGTTGGAGG - Intergenic
1122632619 14:103113943-103113965 TGGCAAAGGAAGGAAGTTTGGGG - Intergenic
1122674470 14:103399721-103399743 AAAAAAAGAAAGGAATTTGGAGG + Intronic
1123208765 14:106738718-106738740 TAGGAAGGAGAGCAAATTGGAGG - Intergenic
1123216228 14:106811695-106811717 AAGGACAGAAAAGAAGTTGAGGG - Intergenic
1123666899 15:22615070-22615092 TGGGGAAGAAAGGAAGTCAGAGG - Intergenic
1124073463 15:26418861-26418883 AAAGAAAGGAAGAAAGTTGGAGG + Intergenic
1124173241 15:27396907-27396929 TAGGAGAAAAAAGAGGTTGGTGG + Intronic
1124320739 15:28709643-28709665 TGGGGAAGAAAGGAAGTCAGAGG - Intronic
1124426663 15:29569157-29569179 AAGAAAAGAGAGGAGGTTGGAGG - Intronic
1124481753 15:30085706-30085728 TGGGGAAGAAAGGAAGTCAGAGG + Intronic
1124488209 15:30137804-30137826 TGGGGAAGAAAGGAAGTCAGAGG + Intronic
1124521838 15:30411495-30411517 TGGGGAAGAAAGGAAGTCAGAGG - Intronic
1124536826 15:30554724-30554746 TGGGGAAGAAAGGAAGTCAGAGG + Intronic
1124543300 15:30606778-30606800 TGGGGAAGAAAGGAAGTCAGAGG + Intronic
1124563254 15:30794230-30794252 TGGGGAAGAAAGGAAGTCAGAGG + Intergenic
1124755317 15:32400516-32400538 TGGGGAAGAAAGGAAGTCAGAGG - Intronic
1124761826 15:32452867-32452889 TGGGGAAGAAAGGAAGTCAGAGG - Intronic
1124776803 15:32596201-32596223 TGGGGAAGAAAGGAAGTCAGAGG + Intronic
1124960031 15:34387003-34387025 TGGGGAAGAAAGGAAGTCGGAGG - Intronic
1124976660 15:34533224-34533246 TGGGGAAGAAAGGAAGTCGGAGG - Intronic
1125203010 15:37118774-37118796 TTGGAAAGCAATGGAGTTGGTGG - Intergenic
1125382940 15:39106475-39106497 AAGGAAAGAAAAGAAAGTGGTGG - Intergenic
1126560728 15:50040853-50040875 CAGGAAAGAAAGGAAGTAGAGGG + Intronic
1127602860 15:60555697-60555719 TGGGAAGAAAAGGAAGGTGGTGG + Intronic
1127676922 15:61248329-61248351 TAAGGAAAAAAGGAAGTTAGAGG + Intergenic
1127774109 15:62252283-62252305 TGGGGAAGAAAGGAAGTCAGAGG - Intergenic
1127905998 15:63376538-63376560 AAGGAAAGAAAGAGAGTGGGAGG - Intronic
1127906537 15:63380296-63380318 TAGGGAAGAAAGGAAGGGGAGGG + Intronic
1128088967 15:64906074-64906096 CAGGAAAGAAAGCAATTTGGCGG - Intronic
1128129143 15:65214286-65214308 CAGGAAAGGAAGGTAGTGGGAGG + Intergenic
1128282906 15:66411430-66411452 TTGGAAGAAAAGGAAGTAGGTGG + Intronic
1128367740 15:67016447-67016469 AAGGAAAGAAAGAAAGGTGGAGG + Intergenic
1129151196 15:73688847-73688869 TAGAAACCAAAGGAATTTGGAGG + Intronic
1129202606 15:74013198-74013220 AAGGAAGAAAAGGAAGATGGAGG - Intronic
1129234506 15:74215903-74215925 AAAGAAAGAAAAAAAGTTGGAGG + Intergenic
1129276109 15:74446301-74446323 GGGGAAGGAAAGGAAGATGGGGG + Intronic
1129905277 15:79182881-79182903 AAGGAAAGAAAGGAAGAGGGAGG - Intergenic
1129991796 15:79971824-79971846 TAGGATAGAAAGCAAATTGGTGG + Intergenic
1130791156 15:87157394-87157416 AAAGAAAGAAAGATAGTTGGAGG - Intergenic
1130876436 15:88018496-88018518 TAGGGAAGCAAGGAAGTTAAGGG - Intronic
1131325097 15:91435416-91435438 GAGGAAGGAAAGGAAGTAGTAGG + Intergenic
1131742751 15:95412132-95412154 TAGGAAAGAAAGGGTGGTGGTGG - Intergenic
1131779460 15:95840961-95840983 TAGGAAAGAGAAGAGGTTAGGGG - Intergenic
1131870825 15:96762728-96762750 AAGTAATGACAGGAAGTTGGTGG - Intergenic
1132428415 15:101740963-101740985 TAGGGAAGGAAGGAAAGTGGAGG - Intronic
1132433622 15:101779478-101779500 TGGGGAAGAAAGGAAGTCAGAGG - Intergenic
1134002167 16:10791424-10791446 TAGAAAAGAAAATAATTTGGGGG - Intronic
1134386630 16:13779576-13779598 TAGAAAAGAAAGTGATTTGGGGG - Intergenic
1134416886 16:14051804-14051826 TTGGAAAGGAAGGATGTTTGGGG - Intergenic
1134617501 16:15662877-15662899 CAAGAAAGAAAGGAAGGTGGAGG - Intronic
1134881381 16:17747542-17747564 AAGGAAAGAAAGGAAGGAGGGGG + Intergenic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1135012726 16:18896699-18896721 GAAGAAAGCAAGAAAGTTGGGGG + Intronic
1135037818 16:19092951-19092973 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1135156155 16:20054707-20054729 AAGGAAAGAAAGGAAGAGGGAGG - Intronic
1135846029 16:25919368-25919390 TAGAAAAGATAGGACATTGGGGG + Intronic
1135976019 16:27109438-27109460 AAGGAAGGAGGGGAAGTTGGAGG + Intergenic
1136087059 16:27892839-27892861 TAGGAAAGAAAAGTAGGTGTTGG + Intronic
1136238380 16:28929015-28929037 AAGGAAAGAAAAGAAGTTAGGGG - Intronic
1136873162 16:33826381-33826403 AAGGACAGAAAAGAAGTTGAGGG + Intergenic
1137408584 16:48209077-48209099 TATGACAGACAGAAAGTTGGGGG + Intronic
1137437640 16:48470383-48470405 TAGGAAAGACAGGAACATAGGGG - Intergenic
1137804597 16:51292155-51292177 CAGGAATTAAAGGAAGTTGGAGG - Intergenic
1137837611 16:51608107-51608129 TAGAAAAGAAAGGATGAAGGTGG - Intergenic
1138163443 16:54777447-54777469 TGGAAGAGAAAGGAAGTTAGAGG + Intergenic
1138342524 16:56299517-56299539 CAGGGAAGAAAGGAAGGTGGGGG - Intronic
1138406903 16:56802974-56802996 TAAAAAAGAAAGGAAGTCTGGGG - Intronic
1139092899 16:63670793-63670815 TAGGAAAGAAAGAAAGAAGAGGG + Intergenic
1140894722 16:79314800-79314822 TAGGAAGGGAAGGAAGTGGATGG - Intergenic
1141814751 16:86402041-86402063 TAGGAAAGAAAGAAGATAGGAGG - Intergenic
1141939857 16:87268131-87268153 TGGCAGAGAAAGGAAGGTGGGGG - Intronic
1142149948 16:88508303-88508325 AAAGAAAGAAAAGAAGTTGTTGG + Intronic
1142205153 16:88779459-88779481 TAGCCAGGAAAGGAGGTTGGGGG - Intronic
1203099010 16_KI270728v1_random:1289674-1289696 AAGGACAGAAAAGAAGTTGAGGG - Intergenic
1142534554 17:605448-605470 AGGGACAGAAAGGAAGATGGGGG + Intronic
1142534613 17:605652-605674 AGGGACAGAAAGGAAGATGGGGG + Intronic
1142534649 17:605788-605810 AGGGACAGAAAGGAAGATGGGGG + Intronic
1142844037 17:2658241-2658263 TAAGAGAGAAAGGGGGTTGGGGG - Intronic
1144034846 17:11355765-11355787 TGGGATAGAAAGGCAGATGGTGG + Intronic
1144748783 17:17633927-17633949 AAGGAAGGAAGGGAAGATGGAGG - Intergenic
1144752076 17:17655906-17655928 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1144807780 17:17979029-17979051 GAGGAGAAAAGGGAAGTTGGGGG + Intronic
1145189347 17:20825245-20825267 GAGGAAAGAAAGGAAGAGAGAGG - Intergenic
1145722749 17:27088810-27088832 GAGGAAAGAGAGGAAGGTGATGG - Intergenic
1145818607 17:27813635-27813657 AAGGAAAGAAAGGGAGTTCTAGG + Intronic
1146130919 17:30274277-30274299 TAGGAAACACAAGAAGTTAGTGG + Intronic
1147271594 17:39276347-39276369 GAAGAAAGAAAGGAAGAAGGAGG + Intronic
1148177942 17:45584306-45584328 GAGGAAAAAGAGGAGGTTGGCGG + Intergenic
1148334506 17:46832414-46832436 GAGGAGAGAAGGGAGGTTGGGGG + Intronic
1148398987 17:47337146-47337168 TAGGAAGAAAAGGAAGGTCGTGG + Intronic
1148398993 17:47337174-47337196 TAGGAAGAAAAGGAAGGTCGTGG + Intronic
1148567931 17:48644802-48644824 CAGAAAAAAAAAGAAGTTGGAGG + Intergenic
1148675342 17:49441656-49441678 GAGGGAAGAGAGGAAGGTGGAGG + Intronic
1148849166 17:50546392-50546414 AACGAGAGAAAGGAACTTGGAGG - Intronic
1148939775 17:51198403-51198425 AACGAGAGAAAGGAACTTGGGGG - Intronic
1149516304 17:57283545-57283567 AAGGAAAGAAAGGAAGAGAGAGG + Intronic
1149516594 17:57285496-57285518 TCAGAAAGAAAGGAAGGTGGTGG + Intronic
1149549257 17:57527776-57527798 AAGGTAAGAATGGAAGATGGGGG - Intronic
1150425773 17:65075882-65075904 TTGGAAAGAAAGGAGGATGGAGG - Intergenic
1150535227 17:66031894-66031916 AAGGAAACAAAGGCAGATGGTGG + Intronic
1150545054 17:66147943-66147965 TAGAAAAAAAACGAAGTTGGAGG - Intronic
1150611611 17:66738048-66738070 TGGGACAGATAGGAAGATGGAGG - Intronic
1150747448 17:67826585-67826607 GAGGAAAAAAAGGGGGTTGGGGG - Intronic
1150792059 17:68206486-68206508 GAGGAAAAAGAGGAGGTTGGGGG - Intergenic
1151400196 17:73850863-73850885 GAGGAAAGAAAGGGAGGAGGCGG - Intergenic
1151810504 17:76437897-76437919 TAAGAATTAAAGGAAGATGGGGG + Intronic
1151944251 17:77310927-77310949 TAGGACAGAAGGGATGATGGGGG - Intronic
1152135014 17:78498648-78498670 CAGGAAAGAAAGAAAGGAGGGGG - Intronic
1152185547 17:78854551-78854573 TAGGAAGGGAAGGATTTTGGAGG - Exonic
1152435509 17:80273918-80273940 TAGAAAGAAAAGGAAGGTGGAGG - Intronic
1152753745 17:82078318-82078340 GAGGGAAGAAAGGACGGTGGTGG + Exonic
1152803489 17:82343116-82343138 TAGAAAAGAAAGGAAAGCGGAGG - Intergenic
1153148599 18:2062873-2062895 GAGGAAAGAAAGGAAAGTGAAGG + Intergenic
1153299895 18:3583258-3583280 AAGGAAAGAAGGGAAGGAGGTGG - Intronic
1153682794 18:7516326-7516348 GAGGAAAGGAAGGAAATAGGAGG + Intergenic
1153692039 18:7603644-7603666 CATTACAGAAAGGAAGTTGGAGG - Intronic
1153731662 18:8019574-8019596 AAGAAAAGAAAAGAAGTAGGAGG - Intronic
1153818179 18:8809012-8809034 AAGGAGAGAAAGGAAGTTTCAGG + Intronic
1154171191 18:12052133-12052155 CAGGAAAGAAAGAACATTGGAGG - Intergenic
1154997582 18:21655540-21655562 TAAGAAAGCAGGAAAGTTGGCGG + Intronic
1155013726 18:21810442-21810464 TGAGAAAGAACAGAAGTTGGAGG + Intronic
1155081385 18:22413453-22413475 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1155234632 18:23806873-23806895 TGGGAAAGAAAAGGAGTTGAGGG - Intronic
1155312767 18:24540694-24540716 AAGGTAAGGAAGGAAGGTGGAGG - Intergenic
1155627392 18:27850511-27850533 AATGAAAGAAAAGAAGTGGGGGG - Intergenic
1155712647 18:28902579-28902601 TTGGAAAGGAAGGAAGTGAGTGG + Intergenic
1156579779 18:38361675-38361697 GAGGAGAGAAAGAAAGATGGGGG + Intergenic
1156770798 18:40721281-40721303 TAGAAAAGAAAGATACTTGGTGG - Intergenic
1156796887 18:41056835-41056857 TGGGAAAAAAAGGTAGGTGGAGG + Intergenic
1156841376 18:41614009-41614031 GAGGAAGGACAGGAAGTTGATGG + Intergenic
1156894933 18:42235180-42235202 GAGGAGAGAAAGGAAGGTCGGGG - Intergenic
1157093313 18:44661804-44661826 TAAGGAATAAAGGAAGTTGACGG - Intergenic
1157292489 18:46419884-46419906 CAGGAAAGAAAGAAGGTTAGAGG - Intronic
1157395537 18:47337914-47337936 TAAGAAAGAAGGGAAGTGGAGGG + Intergenic
1157803996 18:50644531-50644553 TTGGAGAGAAAGGAAGAGGGAGG - Intronic
1158395413 18:57075495-57075517 GGGGAAAGGGAGGAAGTTGGGGG + Intergenic
1158495289 18:57949714-57949736 GAGGAAAGAAAGGCGGGTGGGGG + Intergenic
1158915731 18:62126971-62126993 TAGGAATGGAAGGAAGTTAGGGG - Intronic
1159109667 18:64042270-64042292 TATGAAAGAAAGATAGATGGTGG + Intergenic
1159615811 18:70578464-70578486 TAAGAGAGAAAGGGAGTTGCTGG - Intergenic
1159776017 18:72603637-72603659 GACGAATGAAAGGAAGTTGCAGG - Intronic
1159882418 18:73871111-73871133 TAGGAAAGGAATGAAGAAGGAGG + Intergenic
1159967917 18:74614921-74614943 AAGGGAAGAAATGAAGTGGGTGG - Intronic
1160800647 19:966544-966566 TAGGAAAAAAGGGGAATTGGTGG - Intronic
1160956963 19:1698301-1698323 TAAGAAGAGAAGGAAGTTGGTGG + Intergenic
1161035321 19:2081285-2081307 TTGGAAAAAAAGCAAGTTAGAGG + Intronic
1161476403 19:4488327-4488349 CAGGAAAGCATGGAAGTGGGAGG - Intronic
1161868209 19:6850336-6850358 TAGGATATAAAGGAAGAGGGAGG - Intronic
1161932375 19:7349475-7349497 TAGGTAAGAAAGGAGGGTGGAGG + Intronic
1162096381 19:8312255-8312277 TAAGCAAGAAAGGAAGCAGGAGG + Intronic
1162187943 19:8921864-8921886 TGGGAAGGAAAGGAAGCTGGAGG + Intronic
1162672275 19:12266965-12266987 TTGGAAAGAAAGGCTGTTGGTGG + Intronic
1162936827 19:13985698-13985720 CAGGAAGGAAAGTAAGCTGGGGG + Intronic
1163178282 19:15581020-15581042 AAGGAAAGAAAGAAAGATGGAGG - Intergenic
1163431059 19:17267930-17267952 AAGGAAGAAAAGGAAGTTGGTGG + Intronic
1163622176 19:18367627-18367649 AAGGAAAGAAAGGAAGAAGCAGG + Exonic
1163779542 19:19239355-19239377 TAGGAGGGAAAGGAAGGAGGAGG - Intronic
1164386648 19:27776905-27776927 TAGGAAAAAAAGGAAGGAGGAGG - Intergenic
1164782696 19:30906392-30906414 TCTGAAAGACAGGAAGGTGGAGG - Intergenic
1165127158 19:33606520-33606542 TTGTAAAGAAAAGAAGTGGGAGG - Intergenic
1165835530 19:38752856-38752878 TAGGAAAGAAAGCATGTTTGAGG - Intronic
1165952819 19:39483633-39483655 TAGGAGAAAAATGAAATTGGTGG + Intronic
1166193994 19:41194308-41194330 AGGGAACGACAGGAAGTTGGGGG + Intronic
1166194611 19:41197708-41197730 AAAGAAAGAAAGGAAGAAGGGGG + Intronic
1166556445 19:43703205-43703227 AAGGAAAGAAGGGAAGAGGGAGG - Intergenic
1166758796 19:45212026-45212048 CAGGAGAGGAAGGAGGTTGGGGG - Intronic
1167594336 19:50419167-50419189 CAGGAAAGATAGGAACTGGGGGG - Intronic
1167796197 19:51710740-51710762 CAGGAAAGAAAACAAGGTGGAGG + Intergenic
1167979810 19:53265604-53265626 TTGGAAAGAAAGAGATTTGGGGG - Intergenic
1168147774 19:54429463-54429485 TAGTAGAGAAAGGAATTGGGGGG + Intronic
925776887 2:7344429-7344451 TGGAAAAGAAAGGAAGTAGCAGG + Intergenic
925779517 2:7369590-7369612 AAGGAAAGAAAGGAAGGGAGTGG + Intergenic
926566304 2:14478595-14478617 GAGGTAAGCAAGGGAGTTGGAGG + Intergenic
927223601 2:20738721-20738743 TATTAAAGAATGGAAATTGGAGG + Intronic
927524360 2:23723425-23723447 GAGGAAAGAAAGGAGGAAGGAGG + Intergenic
927589921 2:24346149-24346171 TAGCACAGAAAGGAGGGTGGGGG + Intronic
928282350 2:29959707-29959729 AAGCAAAAAAAGAAAGTTGGAGG + Intergenic
928701406 2:33903009-33903031 TAGCAAAGAAAAGGAGTAGGGGG - Intergenic
929264950 2:39907983-39908005 TAGGAAAGAAAGAAAATTACAGG - Intergenic
929339774 2:40801405-40801427 TAAGAAAGAAAGGAAAAAGGAGG - Intergenic
929505585 2:42525551-42525573 AAGGAAAGGAAGGAAGTAAGGGG - Intronic
929767834 2:44864167-44864189 AAGGAAAAGAACGAAGTTGGAGG + Intergenic
929893565 2:45938602-45938624 TAGGAAAGAATGCAAATTGGAGG - Intronic
930323930 2:49889157-49889179 TCAGAAGGAAAGGAAGTTTGAGG - Intergenic
930733403 2:54750474-54750496 AAGGAAACAAAGGAATTTAGTGG + Intronic
931097304 2:58955615-58955637 GAGGATAGAAAGGAAGGGGGAGG - Intergenic
931189825 2:59989575-59989597 AAGGAAGGAAAGAAAGTTGGGGG - Intergenic
931209393 2:60178261-60178283 TAGGAAGGAAAGGAGGTGGGGGG + Intergenic
931255903 2:60572495-60572517 TGGGAAAGAAAGTAGGTAGGTGG + Intergenic
931465505 2:62483304-62483326 TTGGAAACAAAGGAAATTGTGGG + Intergenic
931618569 2:64186972-64186994 AGGGAAAGAAAGGAATTTGAAGG + Intergenic
932011684 2:67984202-67984224 TTGGAAAGACTGGAAGTAGGTGG - Intergenic
932073945 2:68645868-68645890 GAGCACAGAAAGGAAGCTGGTGG - Exonic
932401897 2:71486470-71486492 TAGGAAAGAGAGGACAGTGGCGG - Intronic
933604967 2:84372968-84372990 TAGGCAAGAAAGGAAGTAAAAGG + Intergenic
933643239 2:84786671-84786693 GAGATAACAAAGGAAGTTGGGGG + Intronic
934074885 2:88419711-88419733 TAAGAAACAGAGGAAATTGGAGG + Intergenic
934916921 2:98307905-98307927 AAGGAAGGAAAGGAGGTTGGGGG - Intronic
935107716 2:100061161-100061183 AAGGAAAGAAAGTAACTTAGAGG - Intronic
935521540 2:104111887-104111909 TTGAAAAGTAAAGAAGTTGGAGG - Intergenic
935718875 2:105962005-105962027 TCAGAATGAAAGGAAGGTGGTGG - Intergenic
935891470 2:107683391-107683413 TGGGAGAGAAAGGAAGTCGTGGG + Intergenic
936279018 2:111122139-111122161 CAGGAGAGAGAGGAAGTTGTTGG + Intronic
936477003 2:112848130-112848152 TAGGAAGGAAAGGAAGGAGGAGG - Intergenic
936755573 2:115706249-115706271 TATGAATTAAAGGAAGTTTGTGG - Intronic
936839980 2:116757643-116757665 TAGGAAAGAAAAGTAGATTGAGG + Intergenic
937034514 2:118769748-118769770 TAGGAATGGAAGGAAGGTTGGGG + Intergenic
937207609 2:120246513-120246535 GAGGAAGGAAAGGATGTTGGTGG - Intronic
937305464 2:120867832-120867854 GAGGAAAGGAAGGAACTGGGTGG + Intronic
937750269 2:125468410-125468432 GAGGAAATAAAGAAAGTTGAGGG - Intergenic
937891847 2:126945180-126945202 AAGCAAAGGGAGGAAGTTGGAGG + Intergenic
938297709 2:130188767-130188789 TAGCATAGAAAGGGAGCTGGAGG + Intronic
938459061 2:131485899-131485921 TAGCATAGAAAGGGAGCTGGAGG - Intronic
938687831 2:133757914-133757936 TAAGAAAGAAAGGGAGATGAAGG - Intergenic
938815992 2:134904653-134904675 GAGTCAAGAAAGGAAGTTGGAGG + Intergenic
939065878 2:137482840-137482862 GAGGAAAGGCAGGAAGTGGGTGG + Intronic
940702740 2:157066305-157066327 GAGGAAAGGAAGGAAGAAGGGGG - Intergenic
941060469 2:160841817-160841839 TGGGAGAGAGAGGAAGATGGTGG + Intergenic
941190975 2:162381378-162381400 CAGGAAAGGAAGGAACTTTGAGG - Intronic
941285939 2:163611871-163611893 TAGGTAACAAAAGAAATTGGGGG - Intronic
941465865 2:165826278-165826300 CAGGAAAAAAAGGAACTTGGAGG - Intergenic
942280354 2:174356576-174356598 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
943025501 2:182623210-182623232 GAGGAAAGAAATGAGGATGGAGG + Intergenic
943183484 2:184575016-184575038 CAGGAAAGAAAGAAAGAAGGAGG + Intergenic
943259420 2:185640062-185640084 CAGGAAAAAAGGGATGTTGGGGG - Intergenic
943398815 2:187377973-187377995 TAGTAGAAGAAGGAAGTTGGAGG + Intronic
943615097 2:190083542-190083564 TAGGCAAAAAAGGAAGACGGTGG + Intronic
943720076 2:191194768-191194790 AAAGCAAGAAAGGAATTTGGAGG - Intergenic
943722184 2:191216542-191216564 TAGTGAAGAAAGGGATTTGGTGG + Intergenic
944376753 2:199054011-199054033 GATGAAAGAAGGCAAGTTGGAGG - Intergenic
944469868 2:200041576-200041598 GAGGAAAGAAATAAGGTTGGGGG - Intergenic
944632518 2:201642072-201642094 TAGGGCAGAAAGAAAGGTGGGGG + Intronic
944711472 2:202338688-202338710 AAGGAAAGAAAGGAAGAAAGAGG - Intergenic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
944894159 2:204146796-204146818 TAGGAAGGAAGGGAAATTGGGGG + Intergenic
945341123 2:208656154-208656176 TAGGAGAGATGTGAAGTTGGGGG + Intronic
945693428 2:213071147-213071169 TATAAAAGAAACCAAGTTGGGGG + Intronic
945695588 2:213099204-213099226 TATAAAAGAAAGGAGGATGGGGG - Intronic
946026526 2:216675024-216675046 GAGGAAAGAGAGGAAAATGGGGG - Exonic
946064457 2:216974739-216974761 TGGAAAAGAAAGGAAGATGGGGG + Intergenic
946079677 2:217106644-217106666 TAGGGAAGAAAAGAAGAAGGTGG - Intergenic
946114665 2:217450878-217450900 TAGGAAGGAAAGGAGGCTGGTGG + Intronic
946190142 2:218003635-218003657 CAGGAAAGAAAGAAAGAAGGGGG - Intergenic
946332491 2:219018281-219018303 TAGGAAACAAAGGCACATGGTGG + Intronic
946350742 2:219150237-219150259 GTGGGAAGAAAGGAAGTTAGTGG + Intronic
946472012 2:219969286-219969308 TAGGAGAGAAAGGAAATAAGGGG + Intergenic
946605085 2:221395287-221395309 TTGGAAGGAAAGGAAGATGAAGG - Intergenic
946638622 2:221758299-221758321 TAGAACATAAAGGAAGTGGGAGG - Intergenic
946647223 2:221850704-221850726 GAGGAAAGAAAGGGTGTTGGTGG + Intergenic
946814662 2:223564602-223564624 TTGCAAAGAAAGCAATTTGGTGG + Intergenic
946915805 2:224520053-224520075 TAGCAGAGATAGAAAGTTGGTGG + Intronic
947628174 2:231634447-231634469 AAGGAAAGAAAGAAAGAAGGGGG + Intergenic
947899569 2:233709871-233709893 TAGGACAGAAGGGAAGTTACTGG - Intronic
1169780811 20:9307637-9307659 GAGAAAAGAAAGCAAGTTGGGGG + Intronic
1170453000 20:16505151-16505173 GAGGAAAGAGAGGAAGAGGGAGG + Intronic
1172027327 20:31957402-31957424 TAGGACAGGAAGGCAGGTGGAGG + Intergenic
1172260308 20:33558472-33558494 AAGGAAAAAAAGGGAGATGGAGG - Intronic
1172693211 20:36804513-36804535 GAGGAAGGGAAGGAAGGTGGGGG - Intronic
1173112406 20:40204608-40204630 AAGTAAAGAAAGGAAGAAGGAGG - Intergenic
1173179731 20:40796770-40796792 TAGGAAAGAAGGGGATCTGGGGG - Intergenic
1173372926 20:42454963-42454985 AATGAAAGACAGGAAGTTGATGG + Intronic
1173608348 20:44348405-44348427 AAGGAAAGAAAGGAAGGGGAAGG - Intronic
1173851302 20:46220106-46220128 AAGGGAAGAAAGGAAGGTAGGGG + Intronic
1174003523 20:47392101-47392123 CAGGAAAGAAAGGAAGAGAGAGG + Intergenic
1174050709 20:47765491-47765513 GAGGGAAGAAAGGAAATTGTGGG + Intronic
1174117002 20:48233165-48233187 GGGGACAGAAAGGAAGTGGGAGG - Intergenic
1175982189 20:62744172-62744194 TGGGAAAGGAAGCAAATTGGGGG - Intronic
1177145507 21:17403280-17403302 GAGAAAAGAGAGGAAGTTAGTGG + Intergenic
1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG + Exonic
1177973999 21:27825120-27825142 AAGAAAAGAAAGGAAGTGGGAGG + Intergenic
1178598318 21:33974664-33974686 GAGGAAGGAAAGGAAGAAGGGGG - Intergenic
1178834198 21:36082718-36082740 TAGGAAAGAAAGCAAGTTCAAGG - Intergenic
1179016728 21:37600365-37600387 AAGCAGAGAAAGGAAGCTGGAGG - Intergenic
1179114098 21:38474277-38474299 TAGGAAAGCCAAGAAGTGGGAGG + Intronic
1179426617 21:41284512-41284534 TAGGAAAGAAGGGAAGAGGCAGG - Intergenic
1179532663 21:42030739-42030761 TAAGAAGGAAGGGAAGGTGGAGG - Intergenic
1180664709 22:17501032-17501054 TAGCAAAGAAAGATACTTGGGGG + Intronic
1181643680 22:24218837-24218859 AAAAAAAGAAAGTAAGTTGGGGG + Intergenic
1181668145 22:24412411-24412433 GAGGAAAGAACGGGTGTTGGTGG + Intronic
1181781844 22:25199570-25199592 AACCAAAGAAAGGGAGTTGGTGG + Intergenic
1182077942 22:27507480-27507502 TAGGAAGGAAAGGAGGGAGGGGG + Intergenic
1182505778 22:30781366-30781388 ATGGAAAGAGAGGAAGGTGGGGG - Intronic
1182773603 22:32814246-32814268 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
1182888171 22:33793781-33793803 TATGAAAAAAAAAAAGTTGGGGG - Intronic
1184114615 22:42415267-42415289 AAAGAAAGAAAGGAAGGTGTAGG - Intronic
1184175256 22:42785384-42785406 TGGGGAAGAAAGGAAGTCAGAGG + Intergenic
1184844292 22:47071609-47071631 AAGGAAAGAATGGAAGTAGCAGG - Intronic
1184962536 22:47941881-47941903 AAAGAAAGAAAGGAATCTGGTGG + Intergenic
1185093339 22:48789491-48789513 AAGGAAAGAAAAGAAACTGGTGG + Intronic
949677051 3:6467438-6467460 AAGGAAAGAAAGGAAAAGGGAGG + Intergenic
949677757 3:6476795-6476817 TAGGAATGAAATGAGCTTGGAGG - Intergenic
950340609 3:12240802-12240824 AAGGAAAGGAAAGAAGGTGGCGG - Intergenic
951142214 3:19176244-19176266 TTTGAAAGTAAGGAAGCTGGAGG + Intronic
951855348 3:27190364-27190386 TGGGGAAGGAAGGAAGTAGGTGG + Intronic
951935721 3:28020859-28020881 TAAGAAAGATGAGAAGTTGGTGG + Intergenic
951963126 3:28350851-28350873 TAAGAAAGAAAAGAATTTAGGGG + Intronic
952011661 3:28906725-28906747 TAGGAAAGAAAGGCTAATGGTGG - Intergenic
952358657 3:32608012-32608034 CAAGAAAGAAAGGAAGTTAATGG + Intergenic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
952953807 3:38544234-38544256 GAGGAAAGGAGGGAAGCTGGAGG - Intergenic
952980988 3:38735816-38735838 AAAGAAAGAGAGGAAGGTGGAGG - Intronic
953526265 3:43691888-43691910 TAGGAAACTGTGGAAGTTGGAGG + Intronic
953730825 3:45446261-45446283 TAGGACAGAAAGTAAATTTGGGG + Intronic
953826146 3:46252603-46252625 AAGGAAGGGAAGGAAGTGGGAGG + Intronic
954559783 3:51547040-51547062 AAAAAAAGAAAGGAAGTTGTTGG + Intronic
954734435 3:52693732-52693754 ACGGAAAGAAAGGAAGCAGGAGG + Exonic
954982740 3:54761063-54761085 TAGGATAGAGAGGGAGTTGGGGG - Intronic
955060753 3:55489639-55489661 GGGGAAAGAAAGCAAGTTGGTGG - Intronic
955104113 3:55879751-55879773 AAGGAAAGAATGGATATTGGGGG - Intronic
955161466 3:56468416-56468438 GAGGAAAGAAGGGAAGGAGGAGG + Intergenic
955327998 3:58024428-58024450 GAAGAGAGAAAGGAGGTTGGTGG - Intronic
955510901 3:59679404-59679426 TAGGAAAGAAGGGAGGTTTCTGG + Intergenic
955576657 3:60372311-60372333 AAGGAAAGAAAAGAGGGTGGTGG - Intronic
955675541 3:61444368-61444390 AAGGAAAGAAAGCAGGGTGGAGG - Intergenic
955934074 3:64086038-64086060 TAGAAAAGAAACCAATTTGGGGG + Intergenic
956880287 3:73503865-73503887 TAGGAAAGAAAGCAAGAGTGGGG + Intronic
956983252 3:74665467-74665489 TAAAACAGAGAGGAAGTTGGAGG - Intergenic
957024483 3:75166000-75166022 GAGGAGAGACAGGAAGCTGGAGG + Intergenic
957145395 3:76416780-76416802 GAGGCAAGAAAGAAAGTTGACGG - Intronic
957679474 3:83414321-83414343 TAGGAAAAGCAGGAAGTTTGAGG - Intergenic
959122465 3:102248779-102248801 CAGGAAAAGAAGGAAATTGGTGG - Intronic
959232550 3:103674216-103674238 TCATAAAGAAAGGAGGTTGGTGG + Intergenic
959252798 3:103970200-103970222 TAGGAAAGAAAGTAATTTAAAGG - Intergenic
959468492 3:106720389-106720411 TAGGAAAAAATGGAAGCTTGGGG - Intergenic
959629810 3:108494919-108494941 TATGAAAGATAGAAAGCTGGGGG - Intronic
959894477 3:111591008-111591030 TAGGAAACAAAAGCAGTTTGGGG + Intronic
959996581 3:112687217-112687239 CAGGAAAGAAAGCAATTTGTAGG + Intergenic
960264371 3:115603504-115603526 CAGGTAAGAGAGGAAGTGGGAGG - Intergenic
960885467 3:122389581-122389603 TTGGAAAGAAATCAAGTTGTAGG + Intronic
961924863 3:130467907-130467929 TTGGAAAGACAGGAAGTAGATGG - Intronic
962005056 3:131340516-131340538 GAGGTAATAAAGGAATTTGGAGG + Intronic
962297564 3:134205615-134205637 TAGGAAAGCCTGGAATTTGGAGG - Intronic
962669827 3:137693610-137693632 AAGGAAAGAAAGAAAGGCGGGGG + Intergenic
962707757 3:138061835-138061857 TGGGAAAGAAAAGGAGGTGGAGG - Intergenic
963209560 3:142673988-142674010 AAGGAAAGAAAGGATGTTTCAGG - Intronic
963253997 3:143126528-143126550 TAGGGAAGAAAGAAAGTTGGAGG - Intergenic
963455017 3:145535047-145535069 TAGTAAAGAGAGAAAATTGGTGG - Intergenic
963730381 3:148965631-148965653 TGGCAAAGGAAGGAAGGTGGGGG + Intergenic
963783549 3:149510624-149510646 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
964041220 3:152264074-152264096 TATGAAATAAAGCAGGTTGGGGG - Intronic
964071796 3:152643900-152643922 TAGCTAAAAAAAGAAGTTGGAGG + Intergenic
964175855 3:153825731-153825753 TAGTAAAGAAAGCATGTTTGAGG + Intergenic
964354238 3:155835417-155835439 TAGAAAAGAAATGATTTTGGGGG - Intronic
964888388 3:161510860-161510882 GAAGAAAGAAAGAAAGTTGGGGG - Intergenic
966419069 3:179719382-179719404 TAGGAAAGAAGGGATGTCGGGGG + Intronic
966598746 3:181753040-181753062 TAGAATAGAAAGGTATTTGGGGG + Intergenic
966599996 3:181765518-181765540 AAGGAAAGGAAGAAAGATGGAGG + Intergenic
967113560 3:186317280-186317302 TAGGAAAGAAAAGAAGAGGCTGG - Intronic
967508011 3:190275815-190275837 GAAGAAAGAAAGGAAGATTGGGG + Intergenic
967534514 3:190587000-190587022 GAGAAAAGAACGGAAGTGGGTGG - Intronic
967662789 3:192133529-192133551 TGGGAAAAAAAGGAAGTGTGAGG + Intergenic
967668489 3:192203898-192203920 TAGTAAAGAAAGTAAATTGCTGG - Intronic
967794242 3:193581574-193581596 TAGGAATGCTAGGAATTTGGGGG - Intronic
967899653 3:194436357-194436379 TAGGAAAGAAGTGGAGTGGGAGG + Intronic
968267777 3:197376044-197376066 AAGGGAAGAATGGATGTTGGGGG - Intergenic
969143482 4:5100356-5100378 AAGGCAAGAAAGGCAGCTGGGGG - Intronic
969938021 4:10702257-10702279 AAGGGAAGAAAGGACGTTGCAGG + Intergenic
969941511 4:10736657-10736679 TAGCCAAGAAGGAAAGTTGGGGG + Intergenic
970207076 4:13665726-13665748 TAGGAAAGACATGAATTTTGGGG - Intergenic
970349837 4:15191382-15191404 TAGGAAGGAGAGGAGGTTGGAGG - Intergenic
970435451 4:16029924-16029946 AGGGAAAGAAAGGAAGTGGAGGG - Intronic
970620655 4:17814407-17814429 AAGAAAAAGAAGGAAGTTGGTGG + Intronic
971099808 4:23452859-23452881 ACGGAAAGAAAAGAGGTTGGTGG - Intergenic
971141035 4:23924894-23924916 TATAAAAGAAAGGAAAGTGGGGG - Intergenic
971582879 4:28365288-28365310 AATGAAAGAAAGGAAGTTGTGGG + Intronic
972513754 4:39793775-39793797 CAGGACAGAAATAAAGTTGGAGG - Intergenic
972672714 4:41229240-41229262 AAAGAAAGAAAGAAAGGTGGGGG - Intergenic
974822429 4:67084225-67084247 TAAGAAAGAAAGAGATTTGGGGG - Intergenic
975156765 4:71080970-71080992 TAGTAAAGGAAGGAAGCAGGGGG - Intergenic
975423099 4:74192204-74192226 TAGGAGGGATAGGATGTTGGAGG + Intronic
975467737 4:74728641-74728663 CAAGAAAGAAAGGACATTGGGGG - Intergenic
975712942 4:77178679-77178701 AGGGAAAGAAAGGAAGCTGCAGG + Intronic
975766054 4:77668801-77668823 GAGGAAAGAAAGAAAATGGGAGG - Intergenic
976267256 4:83195759-83195781 AAGAAAAGAAAGGAAGAAGGTGG - Intergenic
976291989 4:83428645-83428667 CAGGAAAAAAAGCAAGTTGCAGG + Intronic
976386077 4:84460389-84460411 TAGGAAAACAGGGTAGTTGGTGG - Intergenic
976952950 4:90856119-90856141 GAAGGAAGAAAGGAAGATGGGGG - Intronic
977278201 4:95005612-95005634 TAGGAAAGAAAGGAAGGAGCCGG - Intronic
977505241 4:97893806-97893828 AAGGAAAGAATGGATGTTGAGGG + Intronic
977745223 4:100539005-100539027 TAGAAAAGGAAGGAAGCTTGAGG + Intronic
978283491 4:107045620-107045642 TAAAAAAAAAAGGAAGTTTGAGG + Intronic
979304259 4:119124406-119124428 TGGGAAAGGAAGGAATTGGGTGG - Intergenic
979819947 4:125158581-125158603 TAGGATAGAAAGGGAGCTGAGGG + Intergenic
980728478 4:136796992-136797014 AAGGAAAGATAAGAAGTTAGTGG + Intergenic
980735756 4:136885154-136885176 TAGGAAAGAAAGAAGCTTGCAGG - Intergenic
980813328 4:137912542-137912564 TAGGAAAGTAGGGAAGTGGAAGG - Intergenic
980878675 4:138687538-138687560 TAGAAAAGAAAGGAACCAGGAGG + Intergenic
981082270 4:140647354-140647376 TATGATAGAATGGTAGTTGGTGG - Intronic
981167458 4:141578344-141578366 TAGAAAATGAGGGAAGTTGGTGG - Intergenic
981398749 4:144286859-144286881 AAGAAAACAAAGGAAGTTAGAGG - Intergenic
981932088 4:150201192-150201214 AAGGAAAGAAAGAAACTTGGGGG - Intronic
982151144 4:152458796-152458818 CAGGAAAGAAAGGGAGGTGGGGG + Intronic
982512544 4:156301141-156301163 TAGGAATGAAAGGGAGATTGAGG - Intergenic
983040510 4:162919783-162919805 TACAAAAGAAGGGAAGGTGGAGG + Intergenic
983644843 4:169979202-169979224 TAGCAAAGAAAAGAAAATGGGGG + Intergenic
984103307 4:175513925-175513947 GAGGGAAAAAAGGAAGGTGGTGG - Intergenic
984193114 4:176627918-176627940 CTGGGAAGAAAGGAAGTAGGTGG - Intergenic
984365003 4:178787227-178787249 AAGCAAAGAAAGAAAGATGGGGG - Intergenic
984602540 4:181745073-181745095 TAGAGAAGAAAGGAAGATCGAGG + Intergenic
984744805 4:183204066-183204088 GAGGAAAGAAAGAAAGTGGAGGG + Intronic
985121323 4:186645550-186645572 TAGCAAAGTATTGAAGTTGGGGG + Intronic
985834497 5:2260705-2260727 TAGGAAAGAAATGAGTTTGTAGG - Intergenic
985993749 5:3584815-3584837 GAGGAATGAAAGGAAGAAGGGGG + Intergenic
986401495 5:7385942-7385964 TAGGGAGGAGAGGAAGTTGTTGG - Intergenic
986653781 5:9990509-9990531 CAGGTAAGAAAGGGAGTTAGTGG + Intergenic
987200369 5:15571227-15571249 TAGAAAAGAAAAAAAGTTAGAGG - Intronic
987398892 5:17454233-17454255 TGGGAAATAAAGGAGGCTGGTGG + Intergenic
989117301 5:37967621-37967643 TAAAAAAGAAAGTAAGTAGGTGG - Intergenic
989141365 5:38204700-38204722 TAGGAGAGCAAGGCAGCTGGTGG + Intergenic
989430560 5:41350169-41350191 TATGAAAGAATAGAAGTGGGAGG - Intronic
989519458 5:42383614-42383636 CAGCCAAGAAAGGAAGTGGGGGG + Intergenic
989557269 5:42812176-42812198 TGGGAAAGAAGGCAACTTGGAGG - Intronic
990019282 5:51105409-51105431 TAGGAAAAAAAGAAAGTAGAGGG - Intergenic
990684522 5:58286420-58286442 TAATAAAAAAAGGAAGTGGGGGG - Intergenic
990743436 5:58935466-58935488 AAGGAAAGAAAGGAAATTTAGGG - Intergenic
991193776 5:63907446-63907468 CAGGCAAGAAAGGAACTTAGTGG - Intergenic
991385176 5:66079811-66079833 GAACAAAGAAAGGCAGTTGGTGG - Intronic
991453536 5:66778332-66778354 TAGGTAAAACAGGGAGTTGGTGG + Intronic
991668937 5:69027619-69027641 GATGGAGGAAAGGAAGTTGGCGG + Intergenic
992126705 5:73649840-73649862 TGGCAAAGAAAGGAGGCTGGTGG + Intronic
992298342 5:75350478-75350500 TAAGAAAAAAAGGAAGAAGGGGG - Intronic
992342701 5:75841807-75841829 TAGGAAAAAAAGAAAGTTAGAGG - Intergenic
992435300 5:76750472-76750494 AAGGAAGGAAAGAAAGATGGAGG + Intergenic
992735377 5:79714026-79714048 TAGGAAAGACAGAATGATGGTGG + Intronic
993148007 5:84121177-84121199 TAGCAATGAAACTAAGTTGGAGG - Intronic
993587483 5:89748022-89748044 AAGGAAAGAAAGGAAAGTGAAGG - Intergenic
993698175 5:91086803-91086825 CAGGAAAGAAAATAGGTTGGTGG - Intronic
993709629 5:91211926-91211948 TAGGAAAGATTGGAAGTGAGGGG - Intergenic
993735270 5:91468902-91468924 TAAGACTGAAAGGCAGTTGGGGG + Intergenic
995092684 5:108197108-108197130 GAGGAAAGAAAGAGATTTGGTGG - Intronic
995320072 5:110824226-110824248 AAGGAAAGAAAGAAAGGGGGGGG - Intergenic
995322436 5:110851693-110851715 TGGGAAAGAAATGAATTTGGGGG + Intergenic
995453282 5:112326202-112326224 TAGGAAAGAGAGGCAGTCAGTGG - Intronic
995889086 5:116930260-116930282 TAGGAAAGGAAGTAAGTTTTTGG + Intergenic
995978787 5:118076153-118076175 AAGGAGTGACAGGAAGTTGGTGG + Intergenic
996294396 5:121894623-121894645 AAAGAAAGAAAGAAAGTTTGCGG + Intergenic
996673599 5:126149770-126149792 TATAAAAGAAAAAAAGTTGGAGG - Intergenic
997064619 5:130546636-130546658 TAGGAAATTAAGCAAGTTTGTGG + Intergenic
997715847 5:136042068-136042090 TAGGAAAGAAACTAAGTTTGGGG + Intronic
997901225 5:137766750-137766772 GAGGAAAGAAAGGAAGAAGAAGG + Intergenic
998152898 5:139767291-139767313 GAAGAAAGAAAGAAAGATGGTGG - Intergenic
998382546 5:141735967-141735989 TAGGAGGAAAGGGAAGTTGGAGG - Intergenic
998386900 5:141762411-141762433 CTGGAAGGAAAGGAAGTTCGAGG + Intergenic
998411133 5:141912369-141912391 AAGGAGAGAATGGATGTTGGTGG + Intergenic
998590981 5:143477939-143477961 TAGGAAAAAAAGGAAAGAGGAGG - Intergenic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
998814195 5:145995583-145995605 TAGAAAATGAATGAAGTTGGTGG - Intronic
999007608 5:148000022-148000044 AAGGAAAGAAAGGAAAGTGGGGG + Intergenic
999618626 5:153451486-153451508 CAGGAAAGAAGGAAATTTGGGGG + Intergenic
999779355 5:154836523-154836545 TAGGAAAGAACTGGAGGTGGTGG + Intronic
1000168816 5:158681567-158681589 AAGAAAAGAAAGGAAGTTGCCGG + Intergenic
1000453644 5:161421227-161421249 TGTGAAAGAAAGGAAGCTGTGGG + Intronic
1000772002 5:165366198-165366220 GAAGAAAGGAAGGAAGTGGGAGG + Intergenic
1000911300 5:167025987-167026009 TAGGGATGAAAGGAATTTAGAGG - Intergenic
1001026904 5:168232209-168232231 GAGGAAAGAAAGAAGGTAGGGGG + Intronic
1001080570 5:168664547-168664569 AAGAAAAGAAAGGAAGATGGAGG - Intronic
1001502807 5:172251916-172251938 TAGGATGGAAAGGAAGATGAGGG + Intronic
1001763584 5:174227049-174227071 TAAGAATGAATGGATGTTGGGGG - Intronic
1001901769 5:175436902-175436924 AAGAAAAGAAAAGAAGTAGGAGG - Intergenic
1002589592 5:180280793-180280815 TATGAAAGGAAGGAATTTTGAGG + Intronic
1002699575 5:181113204-181113226 TAGAAAAGAAATGATTTTGGAGG - Intergenic
1003468766 6:6409027-6409049 TAGCAGAGAAATGAAGCTGGAGG - Intergenic
1003500451 6:6698637-6698659 ACAGAAAGAAAGGAAGGTGGTGG + Intergenic
1003509698 6:6769237-6769259 TAGGAAAGGTAGGAGGATGGTGG - Intergenic
1003759683 6:9162744-9162766 CAGGAAAGAAAGGAAGAAAGAGG + Intergenic
1003855521 6:10269952-10269974 CAGGGAAGGAAGGAAGGTGGAGG + Intergenic
1004298309 6:14434350-14434372 ATGGCAAGAAAGGAAGGTGGTGG - Intergenic
1004738013 6:18427699-18427721 TAGGAAAGAGGGGAAGATGATGG - Intronic
1004822902 6:19387475-19387497 TAAGAAAGAAAGGAAGGGGGAGG - Intergenic
1005365787 6:25075516-25075538 GAGGGAAGAGAGGAAGATGGAGG + Intergenic
1005939420 6:30549782-30549804 TAGGAGAGAAAGGAAATAGTTGG - Intronic
1006023215 6:31130182-31130204 AAGGATAGAAAGGAAGAAGGAGG - Intronic
1006276190 6:33007217-33007239 TAGGAGAGAAAGGAAGGAGTTGG + Intronic
1006360687 6:33585491-33585513 TAGGCAAGACAGGAAGCAGGAGG - Intergenic
1006851355 6:37101130-37101152 TAGAAAGGAAAGGAAGAGGGAGG + Intergenic
1006989858 6:38205897-38205919 AAAGAAAGAAAGGAAGTTATGGG + Intronic
1007851977 6:44811881-44811903 AAGCATAGGAAGGAAGTTGGAGG - Intronic
1007915230 6:45555360-45555382 TAGGAAAGAGAGGATGTCGAAGG - Intronic
1008593631 6:53018807-53018829 TAAGAGAGAAAGGAAGAGGGAGG + Intronic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1008956831 6:57224719-57224741 GAGGAAAGAAATGATTTTGGGGG - Intergenic
1009830727 6:68929078-68929100 ATGGAATGAAAGGATGTTGGCGG + Intronic
1010020351 6:71152517-71152539 TAAGAAAGACATGAAGTTTGTGG + Intergenic
1010401136 6:75447566-75447588 TAGGATAGAAAGATAGATGGAGG + Intronic
1010950142 6:82026492-82026514 TAGGAAAGAAAAGAACTAAGAGG + Intergenic
1011002086 6:82602146-82602168 TTGGAAAAAAATAAAGTTGGTGG + Intergenic
1011105049 6:83770109-83770131 TAGGGGAAAAGGGAAGTTGGTGG - Intergenic
1011526316 6:88269025-88269047 AAGGAAAGAACTGAAGTGGGTGG + Intergenic
1012027691 6:94018538-94018560 TGGGAAAAACAGGAATTTGGAGG + Intergenic
1012196230 6:96344366-96344388 AAGGAGAGCAAGGAAGCTGGTGG + Intergenic
1012213039 6:96547791-96547813 TCCGAAAGAAGGGAAGTTGGGGG + Intronic
1012259730 6:97073792-97073814 GAGGAAAGAAAGACAGCTGGAGG - Intronic
1012264058 6:97119876-97119898 AAGGAAAGAAAGGAAGAAAGAGG + Intronic
1012952554 6:105534278-105534300 AAGGGAAGAAAGGAATTTAGAGG + Intergenic
1013221703 6:108083380-108083402 AAGGAGAGAATGGATGTTGGAGG - Intronic
1013435785 6:110104977-110104999 TGGCAAAGAAAGGAAGTCAGGGG + Intronic
1014019837 6:116574637-116574659 AAAGAAAGAAAGTAAGTTGTTGG - Intronic
1014720712 6:124914460-124914482 AAAGAAAGAAAGAAAGTTGGAGG - Intergenic
1015118698 6:129677429-129677451 AAGGAAAGAAGGGTAGATGGAGG - Intronic
1015187131 6:130430564-130430586 TAGAAAAAAAAGGAAGATGGTGG - Intronic
1015203720 6:130611797-130611819 GAGAAATGAAATGAAGTTGGAGG - Intergenic
1015314359 6:131801459-131801481 TTGAAAAGAAACAAAGTTGGAGG + Intergenic
1015344830 6:132144175-132144197 AAAGAAAGAAAGTGAGTTGGGGG + Intergenic
1015568202 6:134595395-134595417 TAACAAAGGATGGAAGTTGGAGG + Intergenic
1015597769 6:134881904-134881926 AAGGAAGGAAAGGAAGAAGGGGG - Intergenic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1015739705 6:136440845-136440867 TTGGGAAGAGAGGAAGTTAGGGG - Intronic
1016657276 6:146535174-146535196 TATGAAAGAAAGAAAGTCAGAGG + Intergenic
1016697393 6:147013532-147013554 TGGGAAAATAAGGAAGTTAGAGG + Intergenic
1016940750 6:149481250-149481272 AAAGAAAGAAAGGAAGAGGGAGG + Intronic
1017041086 6:150309152-150309174 CAGGAAAGAAAGGAAGGAGGAGG + Intergenic
1017134191 6:151133855-151133877 TAGGAAAGACAGGGAGATGGTGG + Intergenic
1017208332 6:151827371-151827393 AAGAAAAAAAAAGAAGTTGGAGG + Intronic
1018363460 6:163095851-163095873 TGGAAAAGACAGGAATTTGGGGG + Intronic
1018490527 6:164288017-164288039 TGGGTAAGAAACCAAGTTGGAGG - Intergenic
1020123425 7:5518679-5518701 AAGGAAAAAAAGGGAGTGGGGGG - Intergenic
1020165723 7:5806355-5806377 TAGGAAACCAAGGTGGTTGGGGG - Intergenic
1021013266 7:15498301-15498323 TATCAAAGAAAGGTAGTTAGTGG + Intronic
1021096805 7:16544310-16544332 TAGGAAAGCTAGGATGTTGGAGG - Intronic
1021923514 7:25512013-25512035 CAAGTAAGAAAGGAAGTAGGGGG + Intergenic
1022059410 7:26776459-26776481 TAGGAAGGAAAGGAGGTGGTTGG - Intronic
1022068248 7:26883402-26883424 TAGGAAAGAGGGGAAAGTGGAGG + Intronic
1022393007 7:29959936-29959958 GAAGAAAGAAAGAAAGTGGGGGG + Intronic
1022398170 7:30009586-30009608 GAGGAGAAAAAGGAATTTGGTGG - Intergenic
1022451894 7:30523521-30523543 TGGGGAAGAAAGGAAGTCAGAGG - Intronic
1022828479 7:34040832-34040854 AAGGAAAGAAGGGAGGTGGGAGG + Intronic
1023047094 7:36219629-36219651 AAGGAAAGAAAAGAAGAAGGAGG + Intronic
1023766235 7:43513563-43513585 CGAGAAAGAAAGGAAGTGGGTGG - Intronic
1023876770 7:44290482-44290504 CAGGCAAGAAAGGACGTAGGTGG - Intronic
1024122336 7:46257373-46257395 TGGGAAAGAAAGCAAGAGGGAGG + Intergenic
1024223458 7:47305495-47305517 TAGGGACCAAAGGAAGGTGGAGG - Intronic
1024283190 7:47736237-47736259 AAGGAAAGAAAGAAAGAAGGAGG - Intronic
1024534602 7:50419666-50419688 AAGGACACAAAGGAATTTGGGGG + Intergenic
1024765367 7:52651351-52651373 TAGGACAGAAAGTGAGTTTGAGG + Intergenic
1024993952 7:55256668-55256690 AAGGAAAGAAAGGATTTTGTGGG + Intergenic
1026147362 7:67759044-67759066 TAAGAAAGAAAGGAAGGGGAGGG + Intergenic
1026962848 7:74420109-74420131 AAGGAAAGAAAGAAAGTGGGTGG - Intergenic
1027522509 7:79227853-79227875 CAGGAAAGATAGGAAGTGTGAGG - Intronic
1027571119 7:79868417-79868439 TAGGAGAAAAGGGAAGTTTGGGG + Intergenic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1029839881 7:103350976-103350998 AAGGAAAGAAAAGAAGCAGGCGG - Intronic
1029978030 7:104852377-104852399 TAGGCAGGAAAGGGAGGTGGAGG + Intronic
1031106498 7:117549820-117549842 TGAGGAAGAAAGGAAGTAGGAGG + Intronic
1031842233 7:126757838-126757860 TAGGATAGATAAGAAGGTGGAGG - Intronic
1031865782 7:127037437-127037459 GAGGAAAGAAGTGAGGTTGGGGG - Intronic
1031993566 7:128213317-128213339 TAAGAAAGAAAGGAATGTGGGGG + Intergenic
1032414380 7:131725139-131725161 AAGGAATGGAAGGAAGTTGCTGG + Intergenic
1033120228 7:138661722-138661744 GAGGAGAGAAAAGAATTTGGGGG - Intronic
1033401364 7:141028144-141028166 TAGGAAATAAAGGACCTGGGGGG - Intergenic
1033402445 7:141039432-141039454 TAAGAAACAAAGGGATTTGGAGG - Intergenic
1033660791 7:143400559-143400581 TAGGAAAGAAAGGGATGTGCTGG + Intronic
1034076358 7:148235515-148235537 TGGGGAAGCAGGGAAGTTGGTGG - Intronic
1034412721 7:150949727-150949749 CAGGGTAGAAAGGAAGTGGGGGG + Intronic
1034506528 7:151496652-151496674 TAGGGAAGAAAGAAACCTGGTGG - Intronic
1034589214 7:152125748-152125770 TTTGAAAGAAATAAAGTTGGAGG + Intergenic
1034959828 7:155358308-155358330 GAGGAAAGGAGGGAAGGTGGGGG + Exonic
1035047663 7:155979914-155979936 AAGGAAAGAAAAGAAGGAGGAGG + Intergenic
1035105044 7:156435056-156435078 GAGGAAAGAAATGGAGTTTGGGG + Intergenic
1035120871 7:156565507-156565529 GAGCAAAGGAAGGAAGTGGGTGG + Intergenic
1036005446 8:4656876-4656898 TAGGACAGATAAGATGTTGGGGG - Intronic
1036438501 8:8758585-8758607 CAGGAGAGAAATGGAGTTGGGGG + Intergenic
1036567281 8:9948295-9948317 TGGGAAAGAGAAGAGGTTGGTGG - Intergenic
1037448895 8:18997085-18997107 TAGAAAGGAAAAGAAGTTGAGGG - Intronic
1037554705 8:20010993-20011015 AAAGAAAGAAAGAAAGGTGGAGG - Intergenic
1037559621 8:20061143-20061165 AAGGAAAGAAAGGAAGGGGAGGG + Intergenic
1037580085 8:20239897-20239919 GAGGAAAGAAAGGAACAAGGAGG - Intergenic
1037604465 8:20425727-20425749 CTGGGAAGAAAGGAAGTTGCTGG + Intergenic
1037967113 8:23143582-23143604 TAGGAAAGGAAGAAAATGGGTGG + Intronic
1038018309 8:23532891-23532913 TTGGAAAGCAATGAAGTGGGTGG - Intronic
1038229339 8:25685872-25685894 TAGGAAATAAGGAAAATTGGAGG - Intergenic
1038594390 8:28873578-28873600 TGGGAAGGAAACAAAGTTGGTGG + Intronic
1038629513 8:29227990-29228012 CAGGAAAGAAAGGTAGCTGAAGG - Intronic
1038882218 8:31627616-31627638 GAGGAAGGAAAAGAAGTTGTAGG - Intergenic
1038973087 8:32659691-32659713 TAGGGAAGACAGGAAGTTTGGGG - Intronic
1039216286 8:35275240-35275262 TAGGAAAGATAGGAAATAGGTGG - Intronic
1039579674 8:38654071-38654093 AAGGAAAGAAAGGATTTGGGAGG - Intergenic
1039727732 8:40238106-40238128 AGAGAAAGAAAGGAAGGTGGAGG - Intergenic
1039742346 8:40394197-40394219 GAGGAAAGAAAGAGAGTTTGGGG + Intergenic
1040441266 8:47445436-47445458 GAGGAGAGAAAGTAAGATGGGGG - Intronic
1040444680 8:47481672-47481694 AAGGAAAAAAAAGAACTTGGAGG + Intronic
1040596769 8:48846263-48846285 TACGTAAGAAAGCAAGTTAGTGG + Intergenic
1040850530 8:51897402-51897424 TAGGAAAGATAGAAAGCTAGTGG - Intronic
1040859434 8:51984009-51984031 CTGGAGAGAAAGGAAGTTGTGGG - Intergenic
1041253536 8:55958237-55958259 CAGGAAAGAAGAGAAATTGGAGG - Intronic
1041272856 8:56125678-56125700 TAGGTGAGAAAGGGAGATGGTGG - Intergenic
1041555698 8:59152631-59152653 AAAGAAAGAAAGGAAGAGGGAGG - Intergenic
1041569673 8:59323363-59323385 TAGGACAGAATGGAAGGTGAAGG - Intergenic
1042165049 8:65936859-65936881 TGGAAAAGAAATGAATTTGGGGG + Intergenic
1042173069 8:66010962-66010984 TAGGTAGGAAAGAAAGTTGAAGG + Intergenic
1042530547 8:69810415-69810437 GTGGACAGAAAGGAAGCTGGAGG + Intronic
1042583826 8:70312973-70312995 TAGCAAAGACAGGTAATTGGGGG + Intronic
1042796710 8:72671608-72671630 CAGGAAAGGATGGAAGATGGAGG - Intronic
1042960492 8:74298735-74298757 TAGGAAAGTTAGGAAAGTGGTGG - Intronic
1043126685 8:76405171-76405193 TATGAAAGAAAGGGAATTGTTGG + Intergenic
1043293688 8:78637421-78637443 AAGAAAAGAAAGGAAGTCCGAGG + Intergenic
1043352130 8:79374317-79374339 TAGGAAAGAAATGATTTTGGGGG - Intergenic
1043537954 8:81226746-81226768 CAGGCAAGGAAGGAAGATGGTGG - Intergenic
1043864939 8:85363964-85363986 AAGGAAAGAAAAGAAATTTGGGG - Intronic
1044330254 8:90911252-90911274 TAGGAGAGAAAGGAAGAAAGAGG + Intronic
1044943682 8:97369950-97369972 GAGGAAAAAAAGGGTGTTGGGGG - Intergenic
1045215392 8:100144389-100144411 TAGCAGAGAAAGGACGTTGGAGG - Intronic
1045450954 8:102324631-102324653 TAAGAAACAAAAGAAGATGGTGG + Intronic
1046488431 8:114916246-114916268 TAGAAAAGAAAATAATTTGGGGG + Intergenic
1046673892 8:117087931-117087953 GAGGAAAGAAAGAAAGTAGGCGG + Intronic
1047148607 8:122234550-122234572 GATGCAAGAAAGGAAATTGGAGG + Intergenic
1047702010 8:127458099-127458121 TATGAATGAAAAGGAGTTGGGGG + Intergenic
1047733985 8:127749957-127749979 TAGGAAAGGAAGGATGACGGAGG - Intergenic
1048460407 8:134616625-134616647 AAAGGAAGAAAGGAAGCTGGAGG - Intronic
1048544108 8:135370081-135370103 GATGAAAGAAAGGAAGATGGAGG + Intergenic
1048692738 8:136986445-136986467 TATTAAAGAAAGAAAGTTGGGGG - Intergenic
1048848791 8:138624462-138624484 AAGGAAAGAAAGGAGGAGGGAGG + Intronic
1049907095 9:228079-228101 GAGGAAATAGAGGAAGCTGGTGG + Intronic
1050064440 9:1744106-1744128 TAGGAAAGAAAGCAAGCTGTAGG - Intergenic
1050070485 9:1807208-1807230 TAGAAAAAAAATTAAGTTGGAGG - Intergenic
1051256990 9:15224065-15224087 TAGGAGAGAAAGCAAGATTGAGG - Intronic
1051334303 9:16052763-16052785 GAGGAAAGAAAGAGAGTTTGTGG - Intronic
1052142048 9:24998756-24998778 TTGGAAAGACAGGAAGCAGGTGG + Intergenic
1052175396 9:25456353-25456375 TAGGATAGAGAGGTAGTTGGAGG - Intergenic
1055099163 9:72445470-72445492 GAGGAAAGAAAGGGAGGAGGAGG + Intergenic
1055501910 9:76909709-76909731 ATAGAAAGAAAGGAAGTTGAAGG - Intergenic
1055856429 9:80693148-80693170 TAAGAAAGGAAGGAAGGAGGAGG - Intergenic
1056232637 9:84562498-84562520 GAGGAAAGAAGGGAAGGTGGAGG + Intergenic
1058177396 9:101752802-101752824 TAGGATTGAAAGGATTTTGGAGG + Intergenic
1058483658 9:105422093-105422115 GAGGATAAAAAGGAAGTTGGTGG - Intronic
1058990495 9:110251271-110251293 TAGGAAAGAAAGACAGTTAAAGG - Intronic
1059227083 9:112682131-112682153 GAGGAAAGAAAGGTAGATAGGGG + Intergenic
1059592262 9:115674447-115674469 AAGGAAAGAAAGAAAGAAGGAGG - Intergenic
1060014993 9:120079237-120079259 TGGGACAGAATGGAGGTTGGGGG + Intergenic
1060019189 9:120114508-120114530 TTGGTAAGAAAGGAAGGTAGAGG - Intergenic
1060191131 9:121593591-121593613 AAAGAAAGAAAGAAAGTGGGAGG - Intronic
1061064255 9:128267571-128267593 TGGGGAAGAAACGAAGTTAGAGG - Intronic
1061213774 9:129208592-129208614 TGGGGAAGACAGGAAGTGGGAGG - Intergenic
1061313590 9:129779801-129779823 AAGGAAAGAAGGGAAGGAGGAGG + Intergenic
1061668102 9:132172158-132172180 TTGAAAAGAAAGGAAGGAGGGGG - Intronic
1061750542 9:132773994-132774016 TAGGAAAGAGAGGAAGCATGGGG + Intronic
1185889666 X:3813191-3813213 AAAGAAAAAAAGAAAGTTGGTGG + Intergenic
1186306623 X:8267002-8267024 TATGAAAGAAAGTCAGATGGGGG - Intergenic
1186890280 X:13953042-13953064 CAGGAAAGCAATGAAGTTGAGGG + Intergenic
1187056795 X:15748322-15748344 TAGGAAAGAAAATGATTTGGGGG + Intronic
1187177926 X:16913544-16913566 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1187208764 X:17208449-17208471 AAAGAAAGAAAGGAAGAGGGAGG + Intergenic
1187565881 X:20449093-20449115 TAGAAAAGAAATGAAGTCTGAGG - Intergenic
1187746498 X:22414893-22414915 AAGGAAAGAAAGGAAGAGGGAGG - Intergenic
1188172669 X:26947309-26947331 AAAGAAAGAAAGAAAGCTGGAGG - Intergenic
1188286518 X:28332370-28332392 TTGAAAAGGAAGAAAGTTGGAGG - Intergenic
1188450196 X:30301069-30301091 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1189166990 X:38870212-38870234 AAGGTAAGAAAGGCAGTGGGAGG - Intergenic
1189298117 X:39933301-39933323 AAAAAAAAAAAGGAAGTTGGAGG + Intergenic
1189397066 X:40632409-40632431 TGGGAAAGAAAGGCAATTTGGGG - Intronic
1190032834 X:46991080-46991102 AAAGAAAGAAAGAAAGTGGGGGG - Intronic
1190173364 X:48129271-48129293 TGGGAAAGAAAGGAAGAATGGGG + Intergenic
1190226424 X:48549334-48549356 TATGATAGAAAGGAGGTTGGGGG - Intronic
1190230090 X:48575377-48575399 TAGGAAGAAAAAGAATTTGGAGG - Intronic
1190651560 X:52573337-52573359 TATCAAAGAAAGGAGGCTGGTGG - Intergenic
1191174230 X:57482497-57482519 CAGGAAGTACAGGAAGTTGGGGG - Intronic
1192248649 X:69392971-69392993 TGGGAAAGACCAGAAGTTGGTGG - Intergenic
1192348665 X:70335779-70335801 TAGGAAGCATAGGAAGTTTGAGG + Intronic
1192656401 X:72999446-72999468 TAGGAAAGACAGAGAGTGGGTGG - Intergenic
1192665719 X:73083555-73083577 TAGGAAAGACAGAGAGTGGGTGG + Intergenic
1192781038 X:74293816-74293838 GAGGAAATAAAGGTAGATGGTGG - Intergenic
1193392404 X:80944463-80944485 AGGTAAAGAAAGGAAGTTGATGG - Intergenic
1195677381 X:107517401-107517423 TGGGAAAGTGAGGAAGATGGAGG + Intergenic
1195925127 X:110017395-110017417 AAAGAAAGAAAGGAAGGAGGTGG - Intronic
1195959891 X:110375244-110375266 TAAGAAAGAAAGAAAGATGCTGG + Intronic
1196070281 X:111513264-111513286 AAAGAAAGAAAGGAAGATAGAGG - Intergenic
1196569134 X:117245198-117245220 TTGGAAAAAAAGGAAAGTGGTGG - Intergenic
1196649919 X:118158160-118158182 GAGGTAAGAAATGAAGTTTGAGG - Intergenic
1196753974 X:119141854-119141876 TAGGAGATGAAGGAAGTAGGTGG + Intronic
1196981503 X:121219320-121219342 GAGTAAAGACAGGAATTTGGGGG - Intergenic
1197360071 X:125490844-125490866 TATAAAAGTAAGAAAGTTGGGGG + Intergenic
1197568539 X:128119405-128119427 AAGGAAACAAAGGAGGTTGTAGG - Intergenic
1197739576 X:129879565-129879587 TAGAAAACAAAAAAAGTTGGAGG - Intergenic
1198223638 X:134625653-134625675 AGGGAAAGAACGGAAGTTGTTGG + Intronic
1198260708 X:134962402-134962424 AAAGAAAGAAAGGAAGGAGGAGG - Intergenic
1198383359 X:136105001-136105023 AAGGAAAAAAAGAAAGATGGAGG + Intergenic
1198502292 X:137263308-137263330 TAGGAATGGAAAGAAATTGGTGG + Intergenic
1198661676 X:138975652-138975674 GAGGAAAGAAAGGGCCTTGGAGG + Intronic
1198738726 X:139817425-139817447 TAGGAAATAAAGGAAGCCAGTGG + Intronic
1199419300 X:147625529-147625551 AAGGAAAGTAAGGAGGTAGGGGG + Intergenic
1199447040 X:147937475-147937497 TTGGAAGGAAGGGAATTTGGTGG - Exonic
1199847434 X:151701288-151701310 ATGGAAAGACAGGATGTTGGAGG - Exonic
1199892285 X:152097817-152097839 TAGGAAAGATAGGGGTTTGGGGG + Intergenic
1199977566 X:152903428-152903450 AAAGAAAGAAAGAAAGTAGGGGG + Intergenic
1199997028 X:153031896-153031918 TGGGATAAAATGGAAGTTGGGGG + Intergenic
1200163132 X:154019339-154019361 AAGGAAGGAAAGGAAGGTTGAGG + Intronic
1201338354 Y:12904492-12904514 TAAGGAAGAAGGGAAGTTGAGGG + Intronic
1201341635 Y:12940746-12940768 TAGAAAACAAATGAAGTGGGGGG - Intergenic
1201461512 Y:14230618-14230640 AGGGAAAGAAAGGAAGAGGGAGG + Intergenic
1201549825 Y:15208134-15208156 AAAGAAAGAAAGGAAGAGGGAGG + Intergenic