ID: 1177894573

View in Genome Browser
Species Human (GRCh38)
Location 21:26844549-26844571
Sequence CGTGAATGGCGATCCCAGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177894573_1177894583 29 Left 1177894573 21:26844549-26844571 CCGAGCTGGGATCGCCATTCACG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG 0: 1
1: 1
2: 0
3: 1
4: 31
1177894573_1177894578 4 Left 1177894573 21:26844549-26844571 CCGAGCTGGGATCGCCATTCACG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1177894578 21:26844576-26844598 CGGAGTAGAAGCAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1177894573_1177894579 8 Left 1177894573 21:26844549-26844571 CCGAGCTGGGATCGCCATTCACG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1177894579 21:26844580-26844602 GTAGAAGCAGTGCGCCAGGTCGG 0: 1
1: 0
2: 2
3: 20
4: 130
1177894573_1177894581 21 Left 1177894573 21:26844549-26844571 CCGAGCTGGGATCGCCATTCACG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1177894581 21:26844593-26844615 GCCAGGTCGGTTTCCGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1177894573_1177894580 15 Left 1177894573 21:26844549-26844571 CCGAGCTGGGATCGCCATTCACG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1177894580 21:26844587-26844609 CAGTGCGCCAGGTCGGTTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177894573 Original CRISPR CGTGAATGGCGATCCCAGCT CGG (reversed) Exonic
903455401 1:23483909-23483931 GGTGAAGGGCCATCGCAGCTCGG + Intronic
1070545388 10:77448028-77448050 AGTGAATGCCCATCCAAGCTGGG + Intronic
1076838108 10:133031543-133031565 CCTAAATGGCAATCCCGGCTGGG - Intergenic
1089013919 11:115151534-115151556 CCTGAATGGAGATCTCACCTTGG - Intergenic
1095898802 12:47306458-47306480 AGGGAATGGCGATCCAAGCAGGG - Intergenic
1104376352 12:128267648-128267670 CCAGAAGGGCGCTCCCAGCTGGG + Intronic
1104395794 12:128431526-128431548 CTTGGATGACGATCCCATCTAGG + Intronic
1107752738 13:43586178-43586200 GGTGAATGGCCTGCCCAGCTTGG - Intronic
1121874709 14:97440683-97440705 CGTGCATGGAGATTGCAGCTGGG + Intergenic
1122816001 14:104314372-104314394 CGTGTGTGGAGATCCCAGCCTGG + Intergenic
1125742898 15:41979635-41979657 GATGAAAGGCAATCCCAGCTAGG - Intergenic
1126797904 15:52275228-52275250 CATGAATGCTGATGCCAGCTGGG + Intronic
1135055496 16:19228640-19228662 TGTGAGTGGAAATCCCAGCTAGG + Intronic
1148235138 17:45963802-45963824 AGGGAGTGGCCATCCCAGCTTGG + Intronic
1148410867 17:47465853-47465875 TGTGAATGCTCATCCCAGCTTGG + Intergenic
927217143 2:20674207-20674229 GGTGACTGGAGATTCCAGCTGGG - Intergenic
931321708 2:61178939-61178961 CGTGAATGGAAGCCCCAGCTGGG - Exonic
931841542 2:66155395-66155417 TGAGAATGGGGATACCAGCTGGG + Intergenic
940565076 2:155350951-155350973 GGTGAATGTCGACCCCTGCTGGG + Intergenic
942714780 2:178879791-178879813 CGTCAAAGGGGATCCCAGATGGG + Intronic
1177894573 21:26844549-26844571 CGTGAATGGCGATCCCAGCTCGG - Exonic
1183747442 22:39699707-39699729 CGTGCATTGGGTTCCCAGCTGGG + Intergenic
966969644 3:185031665-185031687 TGTGAATGGAGATGTCAGCTTGG + Intronic
988128434 5:27073331-27073353 AGTGACTGGAGACCCCAGCTGGG - Intronic
1000549111 5:162636879-162636901 GGAGAATGGCCATCCCAGGTGGG - Intergenic
1002351731 5:178588799-178588821 CGTTAATAAAGATCCCAGCTGGG + Intronic
1019475447 7:1241904-1241926 CGGGGAGGGTGATCCCAGCTCGG - Intergenic
1027513633 7:79114078-79114100 CTAGAATGGCAATCCCAGTTTGG - Intronic
1029124268 7:98286102-98286124 CGTGACTGGGGAGCCCATCTGGG + Intronic
1035365623 7:158348258-158348280 TGTGAATGGCGAACCCAGGGTGG - Intronic
1037898713 8:22675319-22675341 GGTGGATGGCTATCCCAGCCAGG - Intergenic
1048461694 8:134626539-134626561 CGTCACTGGGGAGCCCAGCTGGG + Intronic
1049513310 8:143040623-143040645 GGTGAATGGCCATCTCAGCCTGG - Intronic
1051226110 9:14900700-14900722 CAGGGATGGCCATCCCAGCTAGG - Intronic
1192559267 X:72114925-72114947 CAGGAATGGAGATCACAGCTCGG - Intergenic
1195942466 X:110177385-110177407 AGTGCATAGCAATCCCAGCTGGG - Exonic