ID: 1177894576

View in Genome Browser
Species Human (GRCh38)
Location 21:26844563-26844585
Sequence TTCTACTCCGGCACCGTGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177894576_1177894583 15 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG 0: 1
1: 1
2: 0
3: 1
4: 31
1177894576_1177894579 -6 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894579 21:26844580-26844602 GTAGAAGCAGTGCGCCAGGTCGG 0: 1
1: 0
2: 2
3: 20
4: 130
1177894576_1177894585 21 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894585 21:26844607-26844629 CGGAAGCGGCGTCTCGGACCCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1177894576_1177894581 7 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894581 21:26844593-26844615 GCCAGGTCGGTTTCCGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1177894576_1177894580 1 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894580 21:26844587-26844609 CAGTGCGCCAGGTCGGTTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 61
1177894576_1177894578 -10 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894578 21:26844576-26844598 CGGAGTAGAAGCAGTGCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177894576 Original CRISPR TTCTACTCCGGCACCGTGAA TGG (reversed) Exonic
913575786 1:120173265-120173287 TTTTCCTCTGGCATCGTGAAGGG - Intronic
914558100 1:148788836-148788858 TTTTCCTCTGGCATCGTGAAGGG - Intergenic
914614734 1:149341394-149341416 TTTTCCTCTGGCATCGTGAAGGG + Intergenic
919548306 1:198950876-198950898 TTTTTCTCCAGCACCATGAAAGG + Intergenic
1072572895 10:96673997-96674019 TTCTCATCCCTCACCGTGAAAGG + Intronic
1075119699 10:119655401-119655423 TTATACTCAGGCACTGTGACAGG + Intronic
1077581883 11:3422480-3422502 TTCTCCTCGGGCACCATGACGGG + Intergenic
1084117208 11:67049382-67049404 CTCTTCTCCGGCCCCGAGAAAGG - Exonic
1090832269 11:130427964-130427986 TTCTTCTCCGGCACCGTGAATGG - Exonic
1094523595 12:31217899-31217921 TCCTACTGCGGCTCCTTGAAAGG - Intergenic
1096640855 12:52993312-52993334 TTCAGCTCCGGCTCCCTGAAGGG - Intergenic
1103906755 12:124331767-124331789 TTCTACTCCAGCCCCAGGAAGGG + Intronic
1107225477 13:38043980-38044002 TTCTAGTCAGTCACCTTGAAAGG - Intergenic
1110128555 13:71978742-71978764 TCCTACTCTGGACCCGTGAAGGG - Intergenic
1129245443 15:74276345-74276367 TCCTACCCCGGCACCTTGGAAGG + Intronic
1132601013 16:772966-772988 CTCTACTCCCGCACCGAGATCGG - Exonic
1135658757 16:24275885-24275907 TTCTAATCCTGCACGTTGAATGG - Intronic
1138187759 16:54989268-54989290 TTCTACTCCAGCTCCTTGCAGGG - Intergenic
1151188905 17:72383291-72383313 TTCTGCTCCAGCACCGTGGGAGG - Intergenic
948504902 2:238422153-238422175 CTCAGCTCCGGAACCGTGAATGG - Intergenic
1173939824 20:46901169-46901191 TTTTTCTCCGGAACCGTGAGAGG - Intronic
1177894576 21:26844563-26844585 TTCTACTCCGGCACCGTGAATGG - Exonic
970665685 4:18333724-18333746 TTCTATTACGGCAGTGTGAAGGG - Intergenic
973082087 4:46006073-46006095 TTCTACTTCTGCACCGTAAAAGG + Intergenic
973851431 4:54965287-54965309 TACTTCTCCGGCACTGGGAAGGG + Intergenic
979388568 4:120099648-120099670 ATCTACTCAGGCACTTTGAAAGG + Intergenic
998266507 5:140671261-140671283 TTCTCCACAGGCACCCTGAATGG - Exonic
1004640812 6:17513705-17513727 TGCAACCCAGGCACCGTGAAGGG - Intronic
1026317810 7:69242262-69242284 TCCTACTCTGGCCACGTGAAAGG + Intergenic
1027513303 7:79110215-79110237 TTCTACTAAGGCAGTGTGAAAGG + Intronic
1033246498 7:139720892-139720914 TTCCACTTCTGCACCGTGGACGG - Intronic
1036289646 8:7476176-7476198 TTCTATTCCGTTACTGTGAAAGG - Intergenic
1046151280 8:110229692-110229714 TTCTACTCTGGGACCGGGCATGG + Intergenic
1048836518 8:138524106-138524128 TTCTACTCAGACATCCTGAAGGG - Intergenic
1057137919 9:92706958-92706980 TTCTACTCAGGGCCCGTGATGGG + Intergenic
1190758673 X:53422423-53422445 TACTACTCCGGCACCGGATAAGG + Intronic