ID: 1177894577

View in Genome Browser
Species Human (GRCh38)
Location 21:26844575-26844597
Sequence CTGGCGCACTGCTTCTACTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177894577_1177894581 -5 Left 1177894577 21:26844575-26844597 CCGGAGTAGAAGCAGTGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1177894581 21:26844593-26844615 GCCAGGTCGGTTTCCGGAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1177894577_1177894585 9 Left 1177894577 21:26844575-26844597 CCGGAGTAGAAGCAGTGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1177894585 21:26844607-26844629 CGGAAGCGGCGTCTCGGACCCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1177894577_1177894588 29 Left 1177894577 21:26844575-26844597 CCGGAGTAGAAGCAGTGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1177894588 21:26844627-26844649 CGGATTTGCGCCCCACGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 11
1177894577_1177894583 3 Left 1177894577 21:26844575-26844597 CCGGAGTAGAAGCAGTGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG 0: 1
1: 1
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177894577 Original CRISPR CTGGCGCACTGCTTCTACTC CGG (reversed) Exonic
906105401 1:43288897-43288919 CTGGCCTCCTGCTTCTACCCTGG - Intergenic
906296274 1:44650946-44650968 CTGGGCCACAGCCTCTACTCTGG - Exonic
909361564 1:74765553-74765575 CTGGAGCATTTCTTCTAGTCTGG + Exonic
917073651 1:171180284-171180306 CTGGGGCACGGTTTCTCCTCTGG + Intergenic
918488540 1:185054925-185054947 CAGGCGGACTGCTTGTGCTCAGG - Intronic
919935788 1:202249836-202249858 CAGGCCCCCAGCTTCTACTCTGG + Intronic
920294485 1:204947466-204947488 CAGGGGCACTGCTTCTATTCTGG + Intronic
923554787 1:234992047-234992069 CTGGTGCACTGCTTCTCGCCTGG - Intergenic
1066650318 10:37648994-37649016 ATGGGGCACTTCTGCTACTCTGG + Intergenic
1067033267 10:42894834-42894856 ATGGGGCACTTCTGCTACTCTGG + Intergenic
1070252283 10:74783375-74783397 CAGGAGAACTGCTTCAACTCAGG + Intergenic
1076594066 10:131614170-131614192 AAGGGGCTCTGCTTCTACTCAGG - Intergenic
1076902871 10:133348279-133348301 CGGGGGCCCTGCTTCTCCTCAGG - Intronic
1077665996 11:4110243-4110265 CAGGAGAACTGCTTATACTCAGG - Intronic
1077666067 11:4110674-4110696 CAGGAGAACTGCTTATACTCAGG + Intronic
1079383923 11:19962152-19962174 CTGCCACACTGACTCTACTCTGG - Intronic
1080809079 11:35684994-35685016 CTGACTCACTGCTTCATCTCAGG - Intronic
1081152339 11:39647996-39648018 GTGGCGAACTGCTTCAGCTCAGG - Intergenic
1083334764 11:61916251-61916273 CAGGCGAATTGCTTGTACTCAGG + Intronic
1083868521 11:65471956-65471978 CTGGCCCAGGGCTTCTAGTCTGG + Intergenic
1083967095 11:66049585-66049607 CTGGAGCACTGCTTCTCTACTGG - Intergenic
1085087470 11:73680003-73680025 CTGGAGGACTGCTTCAGCTCAGG + Intronic
1087606524 11:100384334-100384356 CTGGGGAACTGCTTCTGCCCTGG - Intergenic
1096575119 12:52548062-52548084 CTGGGACACTGCTTCTATTCTGG + Intronic
1100307919 12:93368152-93368174 GTGGCGCACACCTGCTACTCGGG + Intergenic
1101703351 12:107196150-107196172 CTGGAGAACTCCTACTACTCAGG - Intergenic
1107762496 13:43695538-43695560 CTGGAGAATTGCTTCAACTCGGG - Intronic
1112354049 13:98659937-98659959 CGGGCCCACTGTTTCTACTGGGG + Intergenic
1113064870 13:106362562-106362584 CTAGCTCACTGCTTCTCCTAGGG + Intergenic
1115053166 14:29089702-29089724 CTGGAGCACTGGTTCTCCACTGG - Intergenic
1118527453 14:66661854-66661876 CTGGGGTACTGCTTCTGCCCTGG - Intronic
1119869600 14:78004812-78004834 CTGCCCCACTGCTTCTTCTGAGG + Intergenic
1121113964 14:91330906-91330928 CTTGCCCTCTGCTTCTCCTCTGG - Intronic
1122275954 14:100590912-100590934 CTGGCCCACTGCTCCTCCTGGGG + Intergenic
1123041661 14:105492741-105492763 CTGGCACAGGGCTTCCACTCAGG + Intronic
1123825637 15:24078918-24078940 CTGGGGCTCTGCGTCCACTCTGG - Intergenic
1124567813 15:30832720-30832742 TTGGTGCACTGTTTCTACTTTGG + Intergenic
1126165004 15:45647552-45647574 CGGGCGCACTGCTTGAGCTCAGG - Intronic
1133927304 16:10203586-10203608 CTGGAGAATTGCTTCAACTCAGG + Intergenic
1134050084 16:11131365-11131387 CTGGGGAACAGCTTCTGCTCTGG - Intronic
1143238240 17:5421349-5421371 CTGGCCCACTGCTTCCAGCCTGG - Exonic
1147458783 17:40555260-40555282 CTTGCTCACTGCTGCTCCTCTGG + Exonic
1147472317 17:40674520-40674542 CTGCCGCACTGCTCCAATTCAGG + Intergenic
1150485004 17:65537402-65537424 CGGGTGCACTGCTTCTGCCCTGG - Exonic
1151561604 17:74872848-74872870 AAGGCGCCCTGCTCCTACTCGGG + Exonic
1152393947 17:80020490-80020512 CAGGAGAACTGCTTGTACTCAGG + Intronic
1155091396 18:22515025-22515047 CTGGGGTACTGCTTCTGCCCTGG + Intergenic
1162079074 19:8208398-8208420 CTGGCCCACCGCATGTACTCTGG - Intronic
1165150488 19:33757254-33757276 GTGGCGCACGCCTGCTACTCTGG + Intronic
1166911888 19:46164724-46164746 CCAGCGCACTCCATCTACTCAGG - Intergenic
925769332 2:7267124-7267146 CTGGGGCCCACCTTCTACTCAGG - Intergenic
927292240 2:21416156-21416178 GTGGCTCACAGCTTCTCCTCTGG - Intergenic
927940788 2:27101649-27101671 CTGGCCCTTTGCTTCTTCTCTGG + Exonic
928100225 2:28432478-28432500 CTGGAGAACTCCTTCTTCTCCGG + Intergenic
930152018 2:48068895-48068917 CTGCCTCACTGCTCCTTCTCAGG - Intergenic
935223457 2:101034298-101034320 CTTGCACACTGCTGCTACTAGGG - Intronic
936096956 2:109537716-109537738 CGGGCGGACTGCTTGAACTCAGG + Intergenic
940704565 2:157087730-157087752 CTGGCACAGGGCTCCTACTCAGG + Intergenic
945641133 2:212431445-212431467 CACCCCCACTGCTTCTACTCTGG + Intronic
945735176 2:213589827-213589849 CTGGGGAATTGCTTCTACTTGGG + Intronic
1173481995 20:43409079-43409101 CTGACTCACAGCTTCTACACTGG + Intergenic
1173830225 20:46079064-46079086 CTGGGGCACTCCTTCTGCTCTGG + Intronic
1177894577 21:26844575-26844597 CTGGCGCACTGCTTCTACTCCGG - Exonic
1180107379 21:45629095-45629117 CTGGCTCCATGCTTCTCCTCAGG + Intergenic
1180135503 21:45859553-45859575 CTGGCTCCCTGCCTCTGCTCAGG + Intronic
1180951123 22:19721131-19721153 CTGGCCCACTGCTGCACCTCTGG - Intronic
1184537149 22:45094873-45094895 CTGTCCCACAGCTTCTCCTCTGG + Intergenic
1185359492 22:50397051-50397073 CCGGCTCACTGATGCTACTCTGG - Intronic
949819083 3:8095749-8095771 CTTGCTCACTGCTTTTGCTCAGG - Intergenic
954235420 3:49253330-49253352 CTGGAGAACTGCTTGAACTCAGG + Intronic
966764419 3:183447423-183447445 CTGGGGGTCTGCATCTACTCCGG - Intergenic
968621614 4:1605796-1605818 CTGGCGCACCCCTTCTTCCCAGG + Intergenic
968903018 4:3440007-3440029 CTGGGGCACTTCTCCTCCTCAGG - Intergenic
970657824 4:18251068-18251090 ATGGCTCACTGCTTTTGCTCAGG + Intergenic
973206794 4:47569965-47569987 CTGGCCCTCTGCTGCTTCTCTGG - Intronic
985642087 5:1068339-1068361 CAGGAGAACTGCTTCAACTCGGG + Intronic
989343833 5:40407331-40407353 CTGGGGCACTCCTTCTGCTGTGG - Intergenic
992577393 5:78129716-78129738 CTGGCAAACTGCTTCTCCTGAGG + Intronic
999247639 5:150163708-150163730 CTGGCGCCCCGCCTCTCCTCTGG + Intergenic
1000332687 5:160218551-160218573 CAGGAGAACTGCTTGTACTCGGG - Intronic
1002449033 5:179308726-179308748 CCCGCGCCCTGCTTCCACTCAGG - Intronic
1002644318 5:180645699-180645721 CTGGCGCCCTGCTCCTCCTCCGG + Intronic
1005341525 6:24847984-24848006 CAGGTGCATTGATTCTACTCGGG + Intronic
1014189304 6:118474555-118474577 GTGGGGCACTGGTTCTACGCTGG + Intronic
1017521814 6:155209207-155209229 CTCGCGGGCTGCTTCTAATCTGG - Intronic
1018455789 6:163951212-163951234 CTGGCCCACTGCGTCTCCTTGGG - Intergenic
1018688018 6:166318674-166318696 CTGGAGCCCTGCTTCTTCTGTGG + Intergenic
1022474683 7:30702088-30702110 CTTGCTCCCTGCTTCTGCTCAGG - Intronic
1026133338 7:67637944-67637966 CTTGAGCAATCCTTCTACTCTGG + Intergenic
1028755830 7:94433316-94433338 CTGGCTCAATCCTTCTTCTCTGG + Intergenic
1032204282 7:129848128-129848150 CTGGAGAACTGCTTGAACTCGGG + Intronic
1032896893 7:136261383-136261405 CTGGCTCACGGCTTGTACTGGGG + Intergenic
1035231047 7:157465814-157465836 ATGGGTCACTGCTTCTATTCGGG + Intergenic
1035429370 7:158806527-158806549 ATGCCTCACAGCTTCTACTCAGG + Intronic
1039950817 8:42171240-42171262 CTTACTCACTGCTTCTACTGAGG - Intronic
1049396214 8:142402451-142402473 ATGGCGCACTCCTCCTGCTCTGG - Intronic
1058938839 9:109794519-109794541 CTGGCTCCCTGCTTGGACTCAGG - Intronic
1059206973 9:112476387-112476409 CTGGCCCACAGTTTCTACTAGGG + Intronic
1188089993 X:25952806-25952828 GTAGGGCACAGCTTCTACTCAGG + Intergenic
1196055297 X:111348940-111348962 CTGGCTCACTGCTTTCTCTCTGG + Intronic