ID: 1177894583

View in Genome Browser
Species Human (GRCh38)
Location 21:26844601-26844623
Sequence GGTTTCCGGAAGCGGCGTCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177894573_1177894583 29 Left 1177894573 21:26844549-26844571 CCGAGCTGGGATCGCCATTCACG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG 0: 1
1: 1
2: 0
3: 1
4: 31
1177894577_1177894583 3 Left 1177894577 21:26844575-26844597 CCGGAGTAGAAGCAGTGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG 0: 1
1: 1
2: 0
3: 1
4: 31
1177894576_1177894583 15 Left 1177894576 21:26844563-26844585 CCATTCACGGTGCCGGAGTAGAA 0: 1
1: 1
2: 0
3: 1
4: 33
Right 1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG 0: 1
1: 1
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177894583 Original CRISPR GGTTTCCGGAAGCGGCGTCT CGG Exonic
1067479299 10:46584879-46584901 TGTTTCCCGAGGCAGCGTCTTGG + Intronic
1067615440 10:47756922-47756944 TGTTTCCCGAGGCAGCGTCTTGG - Intergenic
1077140873 11:1024334-1024356 GGTTAGCGGCAGCGGCATCTTGG - Intronic
1078359510 11:10657536-10657558 GGTTTCCCGAAAGGGCTTCTTGG - Intronic
1080458339 11:32434550-32434572 GGATAGCGGAAGCGGCGGCTGGG - Intronic
1094041823 12:26126564-26126586 GGTCGCGGGAAGCGGCGGCTGGG + Intronic
1107453563 13:40534724-40534746 GTTTTCCTGAAGAGGAGTCTGGG - Intergenic
1118315239 14:64722045-64722067 GGATTCCGAAAGTGCCGTCTTGG + Intronic
1131433630 15:92405962-92405984 GACTTCTGGAAGCTGCGTCTGGG - Intronic
1132749020 16:1448841-1448863 GGTTTCTGGGGGCGGCCTCTGGG - Intronic
1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG + Intergenic
1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG + Intergenic
1139403066 16:66697007-66697029 GGGTTCAGGCAGCGGGGTCTTGG + Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1143519573 17:7437726-7437748 GGTTTCTGGAAGCTGCCCCTGGG - Intergenic
1157324309 18:46657732-46657754 GGCTTCCGGAAGTGGCCTCTGGG + Intergenic
1157737439 18:50062693-50062715 GGGTTCAGGATGCGGTGTCTGGG - Intronic
1165070619 19:33253173-33253195 GGTTCCCGGAAGCCGCTGCTGGG - Intergenic
1165122566 19:33569967-33569989 GGATTCCGGAAGCTGGGACTGGG + Intergenic
926050112 2:9739394-9739416 GGTCTGCAGAAGCGGCGTGTGGG - Intergenic
930498883 2:52185521-52185543 GGTTTCGGGGAGCGGTGTCATGG - Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1183427634 22:37747919-37747941 GGCTGCCGGAAGCAGCGTGTGGG + Intronic
953210459 3:40870631-40870653 GGTTTCCAGCAGCGGCTTGTGGG - Intergenic
981423531 4:144578321-144578343 AGTTTCCTGAAGTGGCTTCTTGG - Intergenic
993900588 5:93581646-93581668 GGATTCAGGAATCGGGGTCTCGG + Intergenic
1010220555 6:73444901-73444923 GGTTTCTGGATGGTGCGTCTGGG + Intronic
1016034850 6:139374724-139374746 GTGTTCCGGAATCCGCGTCTTGG - Intergenic
1023743817 7:43303736-43303758 GGTTTCAGGAACAGGTGTCTGGG + Intronic
1029414919 7:100436472-100436494 GGTTTCCGGTAGCGGCGTCTAGG - Exonic
1035404041 7:158587165-158587187 GGTTTAGGGGAGGGGCGTCTCGG - Intronic
1041399385 8:57425846-57425868 GGTTTCCAGAAGCAGAGTGTGGG - Intergenic
1045810617 8:106216088-106216110 GGTTTAAGGAAACGGCGCCTTGG - Intergenic
1062615472 9:137394106-137394128 GGGTTAGGGAAGCGGCGGCTGGG - Intronic