ID: 1177901821

View in Genome Browser
Species Human (GRCh38)
Location 21:26926254-26926276
Sequence CTGTCTAAACAGAAGGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 530}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177901815_1177901821 12 Left 1177901815 21:26926219-26926241 CCACTGCACTCCAGCCCGAGTAA 0: 8
1: 467
2: 15313
3: 180957
4: 294905
Right 1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 530
1177901818_1177901821 -3 Left 1177901818 21:26926234-26926256 CCGAGTAACAGAATGAGATCCTG 0: 1
1: 1
2: 27
3: 346
4: 2149
Right 1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 530
1177901816_1177901821 2 Left 1177901816 21:26926229-26926251 CCAGCCCGAGTAACAGAATGAGA 0: 1
1: 21
2: 704
3: 11729
4: 82005
Right 1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 530
1177901817_1177901821 -2 Left 1177901817 21:26926233-26926255 CCCGAGTAACAGAATGAGATCCT 0: 2
1: 36
2: 707
3: 6654
4: 30925
Right 1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177901821 Original CRISPR CTGTCTAAACAGAAGGTAGT TGG Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
900847846 1:5117878-5117900 ATGACTAGACAGAAGATAGTAGG - Intergenic
902051382 1:13566160-13566182 ATGACTAGACAGAAGATAGTAGG - Intergenic
903396546 1:23006004-23006026 CTGTCTCAAAAAAAGGGAGTTGG + Intergenic
903709749 1:25314653-25314675 TTGTCTATACAGAAGTTAGCTGG - Intronic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
904711997 1:32437078-32437100 ATGACTAGACAGAAGATAGTAGG - Intergenic
904996128 1:34632928-34632950 ATGACTAGACAGAAGATAGTAGG + Intergenic
905060051 1:35132524-35132546 ATGACTAGACAGAAGATAGTAGG + Intergenic
905603279 1:39272465-39272487 CTGTCTAAACAGGAGACAGCTGG + Intronic
906222359 1:44091274-44091296 CTGGCTAAACAGAAGACAGCTGG + Intergenic
906744156 1:48209952-48209974 ATGACTAGACAGAAGATAGTAGG + Intergenic
907499040 1:54865112-54865134 CTGCTTGAACTGAAGGTAGTTGG + Intronic
907504714 1:54909694-54909716 ATGACTAGACAGAAGATAGTAGG + Intergenic
907521622 1:55027329-55027351 ATGACTAGACAGAAGATAGTAGG - Intergenic
908461347 1:64350935-64350957 ATGACTAGACAGAAGATAGTAGG + Intergenic
909035824 1:70593027-70593049 ATGACTAGACAGAAGATAGTAGG - Intergenic
909222386 1:72981421-72981443 ATGACTAGACAGAAGATAGTAGG + Intergenic
909223297 1:72988790-72988812 ATGACTAGACAGAAGATAGTAGG + Intergenic
909518792 1:76543216-76543238 CTGTCTAAAAACAAGGCAGTCGG - Intronic
909550674 1:76895761-76895783 ATGACTAGACAGAAGATAGTAGG + Intronic
909776317 1:79489555-79489577 ATGACTAGACAGAAGATAGTAGG + Intergenic
909792619 1:79697311-79697333 ATGACTAGACAGAAGATAGTAGG + Intergenic
909910325 1:81250194-81250216 ATGACTAGACAGAAGATAGTAGG - Intergenic
909978084 1:82068494-82068516 ATGACTAGACAGAAGATAGTAGG + Intergenic
910049817 1:82960622-82960644 ATGACTAGACAGAAGATAGTAGG - Intergenic
911510232 1:98802041-98802063 ATGTCTAGACAGCAGATAGTAGG + Intergenic
911570745 1:99514360-99514382 ATGACTAGACAGAAGATAGTGGG - Intergenic
912296817 1:108477671-108477693 ATGACTAGACAGAAGATAGTAGG - Intergenic
913095253 1:115510458-115510480 ATGACTAGACAGAAGATAGTAGG + Intergenic
913496127 1:119429904-119429926 CTTGCTCAACAGAAGGCAGTCGG - Intergenic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
916433180 1:164751956-164751978 CTATATAAACAGAAGCTATTTGG + Intronic
916967271 1:169962537-169962559 CTGTCTAAAAAGGAGTTAGAGGG + Intronic
917085015 1:171296520-171296542 CTCACTTAACAGAAGGCAGTTGG - Intergenic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
917681671 1:177374324-177374346 CTGTCTAAACAGCAGGATTTTGG + Intergenic
918507810 1:185277111-185277133 CTGGCTTAATAGAAGGCAGTGGG + Intronic
918567304 1:185949270-185949292 ATGACTAGACAGAAGATAGTAGG + Intronic
919476829 1:198040024-198040046 ATGACTAGACAGAAGATAGTAGG - Intergenic
921164145 1:212494056-212494078 TAGGCTAAACAGAAGGGAGTGGG - Intergenic
921509639 1:216012898-216012920 ATGACTAGACAGAAGATAGTAGG - Intronic
922369020 1:224891162-224891184 ATGACTAGACAGAAGATAGTAGG - Intergenic
922877430 1:228950939-228950961 ATGACTAGACAGAAGATAGTAGG - Intergenic
922906759 1:229179168-229179190 ATGACTAGACAGAAGATAGTAGG - Intergenic
922935252 1:229417666-229417688 ATGACTAGACAGAAGATAGTAGG - Intergenic
923408270 1:233684421-233684443 ATGACTAGACAGAAGATAGTAGG + Intergenic
923963154 1:239106101-239106123 ATGACTAGACAGAAGATAGTAGG - Intergenic
1063111129 10:3038344-3038366 CTATTTAAACAGAAGGTATTTGG - Intergenic
1063363558 10:5476057-5476079 ATGACTAGACAGAAGATAGTAGG - Intergenic
1063509232 10:6630570-6630592 ATGACTAGACAGAAGATAGTAGG + Intergenic
1063962514 10:11318768-11318790 CTGTGTACAGAGAAGGGAGTTGG + Intronic
1064886635 10:20120142-20120164 ATGACTAGACAGAAGATAGTAGG + Intronic
1065438086 10:25721956-25721978 ATGACTAGACAGAAGATAGTAGG - Intergenic
1067580075 10:47439242-47439264 CTTTATAAACAGAAGGTCATGGG - Intergenic
1068057991 10:52034748-52034770 ATGACTAGACAGAAGATAGTAGG + Intronic
1068231338 10:54171494-54171516 ATGACTAGACAGAAGATAGTAGG - Intronic
1069075306 10:64032741-64032763 CTGGCTGAATAGAAGTTAGTGGG + Intergenic
1071897382 10:90082010-90082032 ATGACTAGACAGAAGATAGTAGG + Intergenic
1071961491 10:90812246-90812268 ATGACTAGACAGAAGATAGTAGG - Intronic
1072010907 10:91302231-91302253 ATGACTAGACAGAAGATAGTAGG + Intergenic
1074741167 10:116485548-116485570 ATGACTAGACAGAAGATAGTAGG - Intergenic
1075794449 10:125109166-125109188 TTCTCTAAACAGAAGGATGTGGG - Intronic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1077588251 11:3471189-3471211 ATGACTAGACAGAAGATAGTAGG + Intergenic
1077612555 11:3652672-3652694 ATGACTAGACAGAAGATAGTAGG - Intronic
1077678700 11:4220276-4220298 ATGACTAGACAGAAGATAGTAGG + Intergenic
1077850444 11:6070813-6070835 ATGACTAGACAGAAGATAGTAGG + Intergenic
1077883752 11:6370690-6370712 ATGACTAGACAGAAGATAGTAGG - Intergenic
1078045781 11:7913137-7913159 ATGACTAGACAGAAGATAGTAGG + Intergenic
1078097591 11:8310225-8310247 AAGTCTAATCAGAAGGTTGTGGG + Intergenic
1079534927 11:21502646-21502668 CTGTCTGAAAGGCAGGTAGTAGG - Intronic
1079835489 11:25328182-25328204 ATGACTAGACAGAAGATAGTAGG + Intergenic
1080027546 11:27630056-27630078 ATGACTAGACAGAAGATAGTAGG + Intergenic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1080998211 11:37632243-37632265 CTGTCTAGGCAGGAAGTAGTGGG + Intergenic
1081209301 11:40312120-40312142 ATGTATCAACAGAAGGGAGTTGG - Intronic
1084243948 11:67842816-67842838 ATGACTAGACAGAAGATAGTAGG + Intergenic
1084355912 11:68638432-68638454 ATGACTAGACAGAAGATAGTAGG - Intergenic
1084612918 11:70215209-70215231 ATGACTAGACAGAAGATAGTAGG + Intergenic
1084828742 11:71751748-71751770 ATGACTAGACAGAAGATAGTAGG - Intergenic
1085934644 11:81126518-81126540 GTGACTAGACAGAAGATAGTAGG - Intergenic
1086125203 11:83342931-83342953 ATGACTAGACAGAAGATAGTAGG + Intergenic
1086134335 11:83431585-83431607 ATGACTAGACAGAAGATAGTAGG + Intergenic
1086135808 11:83443075-83443097 ATGACTAGACAGAAGATAGTAGG + Intergenic
1086658510 11:89386263-89386285 TTGACTAGACAGAAGATAGTAGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087099451 11:94350453-94350475 ATGACTAGACAGAAGATAGTAGG - Intergenic
1087128177 11:94646342-94646364 ATGACTAGACAGAAGATAGTAGG - Intergenic
1087315039 11:96592661-96592683 ATGACTAGACAGAAGATAGTAGG - Intergenic
1087992645 11:104764790-104764812 GTATCTAAACAGAAGGTGCTGGG + Intergenic
1089349352 11:117813334-117813356 ATGACTAGACAGAAGATAGTAGG - Intronic
1089470694 11:118717982-118718004 ATGACTAGACAGAAGATAGTAGG + Intergenic
1089625782 11:119750001-119750023 CAGTCTCTACGGAAGGTAGTAGG + Intergenic
1089836179 11:121372708-121372730 CTCACTCAACAGAAGGTAGTAGG - Intergenic
1089953877 11:122553070-122553092 ATGACTAGACAGAAGATAGTAGG - Intergenic
1090526407 11:127543501-127543523 ATGACTAGACAGAAGATAGTAGG + Intergenic
1090546098 11:127769859-127769881 ATGACTAGACAGAAGATAGTAGG + Intergenic
1090573495 11:128073369-128073391 CAGTCTAAAAGGAAGGTACTGGG - Intergenic
1090871600 11:130754489-130754511 ATGACTAGACAGAAGATAGTAGG + Intergenic
1090926566 11:131255469-131255491 ATGACTAGACAGAAGATAGTAGG + Intergenic
1091184074 11:133631735-133631757 ATGACTAGACAGAAGATAGTAGG - Intergenic
1092130523 12:6109518-6109540 CTCTCTAATCAGAAAGTGGTTGG + Intronic
1092474842 12:8809612-8809634 ATGACTAGACAGAAGATAGTAGG - Intergenic
1092580570 12:9836286-9836308 ATGACTAGACAGAAGATAGTAGG - Intronic
1092626396 12:10333968-10333990 ATGACTAGACAGAAGATAGTAGG + Intergenic
1092723375 12:11463157-11463179 ATGACTAGACAGAAGATAGTAGG + Intronic
1092790067 12:12063121-12063143 ATGACTAGACAGAAGATAGTAGG - Intronic
1092924422 12:13260564-13260586 ATGACTAGACAGAAGATAGTAGG + Intergenic
1093579164 12:20768059-20768081 ATGACTAGACAGAAGATAGTAGG - Intergenic
1093584175 12:20818031-20818053 ATGACTAGACAGAAGATAGTAGG + Intronic
1093812438 12:23506849-23506871 ATGACTAGACAGAAGATAGTAGG + Intergenic
1093815023 12:23535008-23535030 CTACCTAAACATAAGGTATTAGG - Intronic
1094411646 12:30173471-30173493 TTGTCTACACAGAATGTAATAGG + Intergenic
1094452592 12:30598358-30598380 CTGTCTAGCCAGAAGGGAGATGG - Intergenic
1095638067 12:44455077-44455099 ATGACTAGACAGAAGATAGTAGG - Intergenic
1096906812 12:54943826-54943848 ATGACTAGACAGAAGATAGTAGG + Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097541725 12:60952191-60952213 ATGACTAGACAGAAGATAGTAGG + Intergenic
1098256421 12:68620756-68620778 CTGTCTCTACAAAAGTTAGTTGG - Intronic
1098653433 12:73002794-73002816 ATGACTAGACAGAAGATAGTAGG + Intergenic
1099021506 12:77410935-77410957 TTGTCACAACAGAAGTTAGTAGG - Intergenic
1099125406 12:78749843-78749865 CTGTCTAAAAAGAAAGTAAAAGG + Intergenic
1099131761 12:78841593-78841615 ATGACTAGACAGAAGATAGTAGG + Intergenic
1099382859 12:81976402-81976424 ATGACTAGACAGAAGATAGTAGG - Intergenic
1099762989 12:86943752-86943774 ATGACTAGACAGAAGATAGTAGG - Intergenic
1100561714 12:95753896-95753918 ATGACTAGACAGAAGATAGTAGG - Intronic
1100940772 12:99720769-99720791 ATGACTAGACAGAAGATAGTAGG - Intronic
1101278037 12:103223664-103223686 ATGACTAGACAGAAGATAGTAGG + Intergenic
1101999802 12:109550237-109550259 CTGTCAAAACAGAAAGGATTGGG - Intergenic
1104497927 12:129258049-129258071 CTGTTTAGACGGAAGGTGGTGGG - Intronic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1106513263 13:30429860-30429882 GTGTCTGAACAGAAGGGGGTGGG + Intergenic
1107160481 13:37220649-37220671 CTTTCTAAACAGAAACTAGTAGG - Intergenic
1108803477 13:54128355-54128377 ATGACTAGACAGAAGATAGTAGG + Intergenic
1108913058 13:55579217-55579239 ATGACTAGACAGAAGATAGTAGG + Intergenic
1109353362 13:61210320-61210342 ATGACTAGACAGAAGATAGTAGG - Intergenic
1109499708 13:63218156-63218178 ATGACTAGACAGAAGATAGTAGG - Intergenic
1109709309 13:66142304-66142326 ATGACTAGACAGAAGATAGTAGG + Intergenic
1110978907 13:81871472-81871494 ATGACTAGACAGAAGATAGTAGG - Intergenic
1111302408 13:86363142-86363164 GTGACTAGACAGAAGATAGTAGG - Intergenic
1111361741 13:87187396-87187418 ATGACTAAACAGAAGATAGTAGG + Intergenic
1111458482 13:88513810-88513832 GTGACTAGACAGAAGATAGTAGG + Intergenic
1112237223 13:97647245-97647267 ATGACTAGACAGAAGATAGTAGG - Intergenic
1112888918 13:104208537-104208559 ATGACTAGACAGAAGATAGTAGG + Intergenic
1113176039 13:107565023-107565045 CTGTATAAACACAAAGAAGTAGG + Intronic
1116534419 14:46013395-46013417 ATGACTAGACAGAAGATAGTAGG + Intergenic
1116702937 14:48263341-48263363 ATGACTAGACAGAAGATAGTAGG + Intergenic
1117094351 14:52282352-52282374 CTCACTCAACAGAAGGCAGTAGG + Intergenic
1117801534 14:59448817-59448839 ATGACTAGACAGAAGATAGTAGG - Intronic
1117957519 14:61134183-61134205 ATGACTAGACAGAAGATAGTAGG + Intergenic
1119022771 14:71129037-71129059 ATGACTAGAAAGAAGGTAGTAGG - Intergenic
1120437688 14:84501189-84501211 ATGACTAGACAGAAGATAGTAGG + Intergenic
1120539116 14:85733380-85733402 ATGACTAGACAGAAGATAGTAGG + Intergenic
1121192742 14:92044536-92044558 ATGAGTAAACAGAAGATAGTAGG + Exonic
1121704052 14:95977900-95977922 ATGACTAGACAGAAGATAGTAGG - Intergenic
1122528885 14:102410725-102410747 ATGACTAGACAGAAGATAGTAGG - Intronic
1125046044 15:35242841-35242863 ATGACTAGACAGAAGATAGTAGG - Intronic
1125131158 15:36286612-36286634 ATGACTAGACAGAAGATAGTAGG + Intergenic
1125614045 15:40993924-40993946 CACTCTAAACAGAAGCTAGAAGG + Intronic
1125711822 15:41793081-41793103 CTGGCTTAACAGAAGGGAGCTGG - Intronic
1126606894 15:50486960-50486982 CTGTCTCAACAAAAAGTAGCCGG + Intronic
1126844225 15:52744223-52744245 ATGACTAGACAGAAGATAGTAGG - Intergenic
1130781475 15:87044548-87044570 ATGACTAGACAGAAGATAGTAGG - Intergenic
1131448136 15:92516456-92516478 ATGACTAGACAGAAGATAGTAGG - Intergenic
1131685118 15:94759411-94759433 ATGACTAGACAGAAGATAGTAGG - Intergenic
1131882158 15:96872848-96872870 ATGACTAGACAGAAGATAGTAGG + Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1132075943 15:98819850-98819872 CTGGCTTAACAGAAGGCAATTGG + Intronic
1132821594 16:1875028-1875050 CTGGCTAAAGAAACGGTAGTTGG + Intronic
1133187782 16:4112803-4112825 CTGTTTAAAAAGGAGGAAGTGGG + Intronic
1133651750 16:7819429-7819451 ATGACTAGACAGAAGATAGTAGG - Intergenic
1133939193 16:10294254-10294276 ATGACTAGACAGAAGATAGTAGG - Intergenic
1135716273 16:24771045-24771067 CTGGCTTAACAGAAGGTAGGTGG - Intronic
1137018239 16:35396580-35396602 GTGACTAATCAGCAGGTAGTGGG - Intergenic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1138805310 16:60083566-60083588 ATGACTAGACAGAAGATAGTAGG - Intergenic
1139109929 16:63877651-63877673 TTTTCTAAACAGAAGGTGGGTGG + Intergenic
1139942688 16:70617452-70617474 ATGACTAGACAGAAGATAGTAGG + Intronic
1141864837 16:86743002-86743024 ATGGCTAGACAGAAGATAGTAGG + Intergenic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1146074761 17:29717861-29717883 CTATCTGAAAAAAAGGTAGTGGG + Intronic
1148432867 17:47656581-47656603 CTGTCTCAACAAAAGATAGCTGG + Intronic
1149245494 17:54700775-54700797 CTATCTATAAAGAAGGTAGGGGG - Intergenic
1150901652 17:69284688-69284710 CTGTCTTAACAGAAGACAGATGG + Intronic
1151622858 17:75257310-75257332 ATGACTAGACAGAAGATAGTAGG - Intronic
1151839391 17:76606936-76606958 ATGACTAGACAGAAGATAGTAGG + Intergenic
1152454501 17:80405697-80405719 ATGACTAGACAGAAGATAGTAGG - Intergenic
1152841219 17:82569863-82569885 CTGTCTAAAAAGAAAGAATTAGG + Intronic
1155941990 18:31809094-31809116 ATGACTAGACAGAAGATAGTAGG - Intergenic
1156302721 18:35849420-35849442 ATGACTAGACAGAAGATAGTAGG - Intergenic
1156938889 18:42741386-42741408 ATGACTAGACAGAAGATAGTAGG - Intergenic
1157175894 18:45451832-45451854 CTTTCAAAACAGAATGTACTTGG - Intronic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1158336731 18:56420331-56420353 ATGACTAGACAGAAGATAGTAGG - Intergenic
1158360610 18:56668278-56668300 CTTTCTAAACAGTAAATAGTAGG - Intronic
1159164848 18:64686365-64686387 ATGACTAGACAGAAGATAGTAGG - Intergenic
1159810704 18:73015263-73015285 CAGTCTAAACAGAAATTATTAGG + Intergenic
1159835409 18:73329378-73329400 ATGACTAGACAGAAGATAGTAGG - Intergenic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
1162665447 19:12206692-12206714 CTGTCTGCACACTAGGTAGTAGG + Intergenic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1163907537 19:20160272-20160294 ATGACTAGACAGAAGATAGTAGG - Intergenic
1164459039 19:28432161-28432183 TTGACTAGACAGAAGATAGTAGG + Intergenic
1165496649 19:36156440-36156462 ATGACTAGACAGAAGATAGTAGG + Intergenic
1165835718 19:38754330-38754352 ATGACTAGACAGAAGATAGTAGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166397094 19:42449451-42449473 ATGACTAGACAGAAGATAGTAGG + Intergenic
1166905227 19:46103660-46103682 ATGACTAGACAGAAGATAGTAGG + Intergenic
1167099830 19:47397753-47397775 ATGACTAGACAGAAGATAGTAGG - Intergenic
1167902507 19:52632482-52632504 ATGACTAGACAGAAGATAGTAGG - Intronic
1168211675 19:54895249-54895271 ATGACTAGACAGAAGATAGTAGG + Intergenic
1168227627 19:55007777-55007799 ATGACTAGACAGAAGATAGTAGG + Intergenic
1168395155 19:56041152-56041174 CTCTCAAAGCAGAAGGCAGTGGG + Intronic
925544913 2:5005717-5005739 ATGACTAGACAGAAGATAGTAGG - Intergenic
926408116 2:12574457-12574479 ATGACTAGACAGAAGATAGTAGG - Intergenic
926985928 2:18623338-18623360 CTGTCTAAAATTAAGTTAGTAGG - Intergenic
928857545 2:35817816-35817838 ATGACTAGACAGAAGATAGTAGG - Intergenic
929004464 2:37381940-37381962 CTGACTAGACAGAAGATAGTAGG + Intergenic
929620028 2:43345385-43345407 TTCTCTAAACAGAAGGTGCTTGG - Intronic
930098479 2:47585223-47585245 GTGACTAGACAGAAGATAGTAGG + Intergenic
931042977 2:58318435-58318457 ATGACTAGACAGAAGATAGTAGG - Intergenic
931107850 2:59076903-59076925 GTTTCTAAACAGAGGATAGTGGG + Intergenic
931282383 2:60805548-60805570 CTGTCTAACCAGTAGGGGGTAGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932853846 2:75214718-75214740 ATGACTAGACAGAAGATAGTGGG + Intergenic
932973553 2:76574614-76574636 ATGACTAGACAGAAGATAGTGGG + Intergenic
933013451 2:77093104-77093126 ATGACTAGACAGAAGATAGTGGG - Intronic
933079632 2:77969846-77969868 ATGACTAGACAGAAGATAGTGGG - Intergenic
933164079 2:79056112-79056134 ATGACTAGACAGAAGATAGTAGG - Intergenic
933179357 2:79212273-79212295 ATGACTAGACAGAAGATAGTAGG + Intronic
933552048 2:83789897-83789919 ATGACTAGACAGAAGATAGTAGG + Intergenic
934141846 2:89054448-89054470 ATGACTAGACAGAAGATAGTAGG - Intergenic
934227394 2:90146098-90146120 ATGACTAGACAGAAGATAGTAGG + Intergenic
936793878 2:116184703-116184725 ATGACTACACAGAAGATAGTAGG + Intergenic
940183464 2:150958796-150958818 ATGACTAGACAGAAGATAGTAGG - Intergenic
940426337 2:153535493-153535515 ATGACTAGACAGAAGATAGTAGG + Intergenic
940508374 2:154583886-154583908 ATGACTAGACAGAAGATAGTAGG + Intergenic
940689230 2:156894432-156894454 CTGTCTAAACAGGAGTGAATAGG - Intergenic
940915603 2:159251827-159251849 CTGACGAAACAGAAGGTAACGGG + Intronic
941699071 2:168584611-168584633 CTGTCAAAACAGATAATAGTGGG + Intronic
941751057 2:169135823-169135845 ATGACTAGACAGAAGATAGTAGG - Intronic
942729900 2:179052525-179052547 ATGACTAGACAGAAGATAGTAGG + Intergenic
943421223 2:187671465-187671487 ATGACTAGACAGAAGATAGTAGG + Intergenic
943460752 2:188169639-188169661 ATGACTAGACAGAAGATAGTAGG + Intergenic
943835756 2:192512207-192512229 ATGACTAGACAGAAGATAGTAGG - Intergenic
943950915 2:194131648-194131670 ATGACTAGACAGAAGATAGTAGG + Intergenic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945173858 2:207022311-207022333 ATGACTAGACAGAAGATAGTAGG - Intergenic
945301067 2:208216877-208216899 ATGACTAGACAGAAGATAGTAGG + Intergenic
946893634 2:224301391-224301413 ATGACTAGACAGAAGATAGTAGG - Intergenic
948391053 2:237611685-237611707 ATGACTAGACAGAAGATAGTAGG - Intergenic
1170068499 20:12341244-12341266 ATGACTAGACAGAAGATAGTAGG + Intergenic
1170106598 20:12758617-12758639 ATGACTAGACAGAAGATAGTAGG - Intergenic
1170166105 20:13361676-13361698 ATGACTAGACAGAAGATAGTAGG - Intergenic
1172364747 20:34340332-34340354 CTGTTTAAACTGAAGTGAGTTGG + Intergenic
1173102256 20:40098021-40098043 ATGACTAGACAGAAGATAGTAGG - Intergenic
1173119227 20:40273749-40273771 ATGACTAGACAGAAGATAGTAGG - Intergenic
1173782074 20:45764352-45764374 ATGACTAGACAGAAGATAGTAGG - Intronic
1174312420 20:49668348-49668370 CTGTCTAAACAGATACTAGATGG + Intronic
1175035344 20:55995195-55995217 ATTTGTAAACAGCAGGTAGTTGG - Intergenic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1175842191 20:62035629-62035651 CTTTCTAACCCGAAGGTAATAGG - Intronic
1177030774 21:15980604-15980626 ATGACTAGACAGAAGATAGTAGG + Intergenic
1177103078 21:16918938-16918960 ATGACTAGACAGAAGATAGTAGG - Intergenic
1177299508 21:19223923-19223945 CTGACTGAACACAAAGTAGTAGG - Intergenic
1177840347 21:26228812-26228834 ATGACTAGACAGAAGATAGTAGG + Intergenic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1178001565 21:28165937-28165959 ATGACTAGACAGAAGATAGTAGG - Intergenic
1181739757 22:24911455-24911477 GTGTCTAAAGTGTAGGTAGTTGG - Intronic
1182246868 22:28965064-28965086 CTGTCAAAAGAGAAGGGAGCAGG + Intronic
1182732640 22:32507510-32507532 ATGACTAGACAGAAGATAGTAGG - Intergenic
1182998977 22:34839051-34839073 ATGACTAGACAGAAGATAGTAGG - Intergenic
1183563293 22:38593990-38594012 CTATTTAAACATAAGGTAGAAGG - Intronic
1183928894 22:41224974-41224996 CAGTCTACACAGAAGGCGGTTGG + Exonic
949161730 3:891641-891663 ATGACTAGACAGAAGATAGTAGG + Intergenic
949827801 3:8181746-8181768 ATGACTAGACAGAAGATAGTAGG - Intergenic
950720103 3:14876621-14876643 CTGGCTGAACAGAAGGTAGCTGG + Intronic
950926856 3:16749053-16749075 ATGACTAGACAGAAGATAGTAGG - Intergenic
951298454 3:20968485-20968507 ATGACTAGACAGAAGATAGTAGG + Intergenic
952663105 3:35875301-35875323 ATGACTAGACAGAAGATAGTAGG + Intergenic
953076773 3:39578779-39578801 ATGACTAGACAGAAGATAGTAGG + Intergenic
953177552 3:40565710-40565732 ATGACTAGACAGAAGATAGTAGG - Intronic
953599042 3:44345932-44345954 ATGACTAGACAGAAGATAGTAGG + Intronic
954161133 3:48723459-48723481 ATGACTACACAGAAGATAGTAGG + Intronic
956548595 3:70435623-70435645 ATGACTAGACAGAAGATAGTAGG + Intergenic
956709626 3:72027937-72027959 ATGACTAGACAGAAGATAGTAGG - Intergenic
957316469 3:78582207-78582229 ATGACTAGACAGAAGATAGTAGG + Intergenic
957451898 3:80390151-80390173 ATGACTAGACAGAAGATAGTAGG - Intergenic
957904360 3:86538422-86538444 ATGACTAGACAGAAGATAGTAGG + Intergenic
958676349 3:97273396-97273418 ATGACTAGACAGAAGATAGTAGG + Intronic
959485404 3:106923698-106923720 ATGACTAGACAGAAGATAGTAGG + Intergenic
960282508 3:115794473-115794495 ATGACTAGACAGAAGATAGTAGG + Intergenic
960309772 3:116106334-116106356 ATGACTAGACAGAAGATAGTAGG + Intronic
960438850 3:117661880-117661902 CTACCTAGATAGAAGGTAGTAGG - Intergenic
960787789 3:121392934-121392956 TTGTATAAATAGCAGGTAGTGGG + Intronic
961881408 3:130064004-130064026 ATGACTAGACAGAAGATAGTAGG - Intergenic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963663711 3:148156385-148156407 ATGACTAGACAGAAGATAGTAGG - Intergenic
963684686 3:148419083-148419105 ATGACTAGACAGAAGATAGTAGG - Intergenic
963707414 3:148704726-148704748 CTGTCAAAACAGGAGATATTCGG - Intronic
964068251 3:152602185-152602207 ATGACTAGACAGAAGATAGTAGG - Intergenic
964125022 3:153227099-153227121 ATGACTAGACAGAAGATAGTAGG + Intergenic
964906170 3:161722860-161722882 GTGACTAGACAGAAGATAGTAGG + Intergenic
964984564 3:162723735-162723757 ATGACTAGACAGAAGATAGTAGG + Intergenic
964998183 3:162914589-162914611 CTGGCCAAACACAAGGTAGCTGG - Intergenic
965211330 3:165793328-165793350 CTGTCTGAAGAGATGGTAGGAGG - Intronic
965262250 3:166501543-166501565 ATGACTAGACAGAAGATAGTAGG + Intergenic
965639616 3:170818556-170818578 ATGACTAGACAGAAGATAGTAGG + Intronic
965861524 3:173156175-173156197 GTGACTAGACAGAAGATAGTAGG + Intergenic
966085844 3:176066370-176066392 ATGACTAGACAGAAGATAGTAGG - Intergenic
966104735 3:176322611-176322633 ATGACTAGACAGAAGATAGTAGG + Intergenic
966232495 3:177666826-177666848 ATGACTAGACAGAAGATAGTAGG + Intergenic
966398015 3:179521517-179521539 ATGACTAGACAGAAGATAGTAGG - Intergenic
967211802 3:187176500-187176522 ATGACTAGACAGAAGATAGTAGG + Intronic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
967624258 3:191667250-191667272 ATGACTAGACAGAAGATAGTAGG + Intergenic
967643458 3:191896315-191896337 ATGACTAGACAGAAGATAGTAGG + Intergenic
967657748 3:192072061-192072083 ATGACTAGACAGAAGATAGTAGG + Intergenic
968874300 4:3257213-3257235 CTGCCCAAATAGAAGGTTGTTGG + Intronic
968993728 4:3932107-3932129 TTGACTAGACAGAAGATAGTAGG - Intergenic
969003429 4:4001023-4001045 ATGACTAGACAGAAGATAGTAGG + Intergenic
969653658 4:8483379-8483401 ATGACTAGACAGAAGATAGTAGG + Intronic
969810500 4:9643801-9643823 ATGACTAGACAGAAGATAGTAGG - Intergenic
970042422 4:11811018-11811040 ATGACTAGACAGAAGATAGTAGG - Intergenic
970084688 4:12333588-12333610 ATGTCTAAACAAACTGTAGTGGG - Intergenic
970533155 4:17002912-17002934 ATGACTAAACAGAAGATAGTAGG - Intergenic
971180826 4:24327274-24327296 ATGACTAGACAGAAGATAGTAGG - Intergenic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
974143416 4:57917890-57917912 CTGTCTCAACAGAATGTTCTAGG + Intergenic
974173033 4:58292059-58292081 ATGACTAGACAGAAGATAGTAGG + Intergenic
974314098 4:60255311-60255333 CTGAGAAAATAGAAGGTAGTTGG - Intergenic
974428042 4:61765235-61765257 ATGACTAGACAGAAGATAGTAGG + Intronic
974904271 4:68036262-68036284 ATGACTAGACAGAAGATAGTAGG - Intergenic
975864735 4:78714834-78714856 ATGACTAGACAGAAGGTAGTAGG + Intergenic
975933526 4:79554952-79554974 ATGACTAGACAGAAGATAGTAGG + Intergenic
976558973 4:86479499-86479521 ATGACTAGACAGAAGATAGTAGG - Intronic
976697807 4:87936909-87936931 ATGACTAGACAGAAGATAGTAGG + Intergenic
976719127 4:88153267-88153289 ATGACTAGACAGAAGATAGTAGG + Intronic
976884206 4:89965735-89965757 ATGACTAGACAGAAGATAGTAGG + Intergenic
977012566 4:91655594-91655616 ATGACTAGACAGAAGATAGTAGG + Intergenic
977074843 4:92439945-92439967 ATGACTAGACAGAAGATAGTAGG + Intronic
977198071 4:94085603-94085625 ATGACTAGACAGAAGATAGTAGG + Intergenic
977224905 4:94383888-94383910 CTGTCTAGACAGAAGATAGTAGG + Intergenic
977782066 4:100992631-100992653 ATGACTAGACAGAAGATAGTAGG + Intergenic
978000762 4:103554742-103554764 ATGACTAGACAGAAGATAGTAGG + Intergenic
978031881 4:103946031-103946053 ATGACTAGACAGAAGATAGTAGG - Intergenic
978438975 4:108713888-108713910 ATGACTAGACAGAAGATAGTAGG - Intergenic
979054261 4:115976640-115976662 ATGACTAGACAGAAGATAGTAGG + Intergenic
979146970 4:117256825-117256847 ATGACTAGACAGAAGATAGTAGG - Intergenic
979380296 4:119998659-119998681 ATGACTAGACAGAAGATAGTAGG - Intergenic
979849946 4:125562607-125562629 ATGACTAGACAGAAGATAGTAGG + Intergenic
980002952 4:127511925-127511947 ATGACTAGACAGAAGATAGTAGG + Intergenic
980111550 4:128641839-128641861 ATGACTAGACAGAAGATAGTAGG + Intergenic
980285328 4:130772309-130772331 ATGACTAGACAGAAGATAGTAGG - Intergenic
981197452 4:141938257-141938279 ATGTCCACACAGAAGGTTGTGGG - Intergenic
981947383 4:150363592-150363614 CTGTATAACCAGTATGTAGTAGG + Intronic
982319360 4:154062435-154062457 ATGACTAGACAGAAGATAGTAGG - Intergenic
982396303 4:154919271-154919293 ATGACTAGACAGAAGATAGTAGG + Intergenic
982496768 4:156104461-156104483 ATGACTAGACAGAAGATAGTAGG + Intergenic
982651931 4:158097304-158097326 CTGTCTAATCATTAGGCAGTAGG - Intergenic
983056175 4:163101290-163101312 ATGACTAGACAGAAGATAGTAGG + Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983320030 4:166184774-166184796 CAGTCTATAAACAAGGTAGTGGG + Intergenic
983452700 4:167927629-167927651 ATGACTAGACAGAAGATAGTAGG - Intergenic
984098646 4:175462158-175462180 ATGACTAGACAGAAGATAGTAGG + Intergenic
984437734 4:179725932-179725954 ATGACTAGACAGAAGATAGTAGG - Intergenic
986424692 5:7619315-7619337 GTGTTGAGACAGAAGGTAGTAGG + Intronic
986554651 5:8999308-8999330 ATGACTAGACAGAAGATAGTAGG + Intergenic
987282357 5:16424456-16424478 ATGACTAGACAGAAGATAGTAGG - Intergenic
987487844 5:18543005-18543027 ATGACTAGACAGAAGATAGTAGG - Intergenic
987497769 5:18669833-18669855 ATGACTAGACAGAAGATAGTAGG + Intergenic
987756191 5:22099578-22099600 ATGACTAGACAGAAGATAGTAGG - Intronic
987851234 5:23358051-23358073 CTGTCTTACTAGAAGATAGTTGG + Intergenic
989219250 5:38937037-38937059 CCGTCTCAAAAAAAGGTAGTTGG - Intronic
992380290 5:76229622-76229644 CTGTCTAAACAGGAAATGGTAGG - Intronic
992395026 5:76362063-76362085 ATGACTAGACAGAAGATAGTAGG - Intergenic
994125659 5:96167350-96167372 ATGACTAGACAGAAGATAGTAGG + Intergenic
994295569 5:98084362-98084384 ATGACTAGACAGAAGATAGTAGG - Intergenic
994295945 5:98088600-98088622 ATGACTAGACAGAAGATAGTAGG - Intergenic
994557268 5:101319630-101319652 ATGACTAGACAGAAGATAGTAGG - Intergenic
994776036 5:104036346-104036368 ATGACTAGACAGAAGATAGTAGG - Intergenic
994778531 5:104064617-104064639 ATGACTAGACAGAAGATAGTAGG + Intergenic
994989901 5:106983080-106983102 ATGACTAAACAGAAGATAGTAGG - Intergenic
995122861 5:108554015-108554037 ATGACTAGACAGAAGATAGTAGG - Intergenic
995297017 5:110534569-110534591 ATGACTAGACAGAAGATAGTAGG - Intronic
995899021 5:117047393-117047415 ATGACTAGACAGAAGATAGTAGG + Intergenic
996202905 5:120698563-120698585 ATGACTAGACAGAAGATAGTAGG + Intergenic
996358182 5:122619411-122619433 ATGACTAGACAGAAGATAGTAGG + Intergenic
996528405 5:124501784-124501806 ATGACTAGACAGAAAGTAGTAGG - Intergenic
996745037 5:126840320-126840342 ATGACTAGACAGAAGATAGTAGG + Intergenic
997501650 5:134379785-134379807 CTGGCTTAACAGAAGATAGCTGG - Intronic
997772288 5:136566320-136566342 ATGACTAGACAGAAGATAGTAGG + Intergenic
1000519039 5:162276377-162276399 ATGACTAGACAGAAGATAGTAGG + Intergenic
1000935273 5:167298898-167298920 GTGACTAGACAGAAGATAGTAGG + Intronic
1001464020 5:171946341-171946363 ATGTCTACACAGCAGGTAGAGGG + Intronic
1003100499 6:3172892-3172914 ATGACTAGACAGAAGATAGTAGG - Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1004106626 6:12672094-12672116 ATGACTAGACAGAAGATAGTAGG - Intergenic
1004198090 6:13523870-13523892 CTCTCAGAACAGAAGGCAGTTGG - Intergenic
1004283155 6:14297931-14297953 ATGACTAGACAGAAGATAGTAGG + Intergenic
1004507641 6:16259966-16259988 ATGACTAGACAGAAGATAGTAGG + Intronic
1004575590 6:16890683-16890705 ATGACTAGACAGAAGATAGTAGG - Intergenic
1004837404 6:19543850-19543872 ATGACTAGACAGAAGATAGTAGG - Intergenic
1005014294 6:21362482-21362504 ATGACTAGACAGAAGATAGTAGG + Intergenic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1007082953 6:39121615-39121637 ATGACTAGACAGAAGATAGTAGG - Intergenic
1007300417 6:40863868-40863890 ATGACTAGACAGAAGATAGTAGG + Intergenic
1008476996 6:51943418-51943440 ATGACTAGACAGAAGATAGTAGG - Intronic
1009359723 6:62796482-62796504 GTGACTAGACAGAAGATAGTAGG - Intergenic
1009749815 6:67869091-67869113 ATGACTAAACAGAAGATAGAAGG + Intergenic
1010627361 6:78154573-78154595 CTGTCTAAAAAGAAAGAAGTAGG - Intergenic
1010826596 6:80483768-80483790 ATGACTAGACAGAAGATAGTAGG + Intergenic
1010840908 6:80648485-80648507 ATGACTAGACAGAAGATAGTAGG + Intergenic
1012316172 6:97784310-97784332 ATGACTAGACAGAAGATAGTAGG - Intergenic
1012675515 6:102107197-102107219 ATGACTAGACAGAAGATAGTAGG - Intergenic
1013021391 6:106223974-106223996 TTGTCAAAACAAAAGGTAGAAGG + Intronic
1014359804 6:120463254-120463276 ATGACTAGACAGAAGATAGTAGG + Intergenic
1014396434 6:120929907-120929929 ATGACTAGACAGAAGATAGTGGG - Intergenic
1014454511 6:121621410-121621432 ATGACTAGACAGAAGATAGTAGG + Intergenic
1014556208 6:122844556-122844578 ATGACTAGACAGAAGATAGTAGG - Intergenic
1014614310 6:123583271-123583293 ATGACTAGACAGAAGATAGTAGG + Intronic
1014712165 6:124819711-124819733 CTGTTTCAACAGTAGGTAATAGG - Intronic
1014719254 6:124896769-124896791 ATGACTAGACAGAAGATAGTAGG - Intergenic
1014793627 6:125702839-125702861 ATGACTAGACAGAAGATAGTAGG + Intergenic
1015165597 6:130197262-130197284 ATGACTAGACAGAAGATAGTAGG - Intronic
1015267103 6:131300184-131300206 ATGACTAGACAGAAGATAGTAGG - Intergenic
1015270005 6:131328129-131328151 ATGACTAGACAGAAGATAGTAGG - Intergenic
1015271719 6:131343553-131343575 ATGACTAGACAGAAGATAGTAGG - Intergenic
1015278511 6:131407550-131407572 ATGACTAGACAGAAGATAGTAGG - Intergenic
1015287693 6:131505316-131505338 ATGACTAGACAGAAGATAGTAGG + Intergenic
1015800923 6:137061556-137061578 ATGACTAGACAGAAGATAGTAGG + Intergenic
1016113787 6:140258440-140258462 ATGACTAGACAGAAGATAGTAGG + Intergenic
1016519155 6:144927863-144927885 ATGACTAGACAGAAGATAGTAGG - Intergenic
1016535395 6:145104128-145104150 ATGACTAGACAGAAGATAGTAGG + Intergenic
1016853634 6:148644537-148644559 ATGACTAGACAGAAGTTAGTAGG - Intergenic
1018084139 6:160287551-160287573 ATGACTAGACAGAAGATAGTAGG + Intergenic
1018495035 6:164339714-164339736 ATGACTAGACAGAAGATAGTAGG + Intergenic
1019092653 6:169552248-169552270 ATGGCTAAACGGAAGGAAGTGGG - Intronic
1021430275 7:20550732-20550754 ATGACTAGACAGAAGATAGTAGG - Intergenic
1021811007 7:24400985-24401007 ATGACTAGACAGAAGATAGTAGG - Intergenic
1022572396 7:31467796-31467818 ATGACTAGACAGAAGATAGTAGG + Intergenic
1023619818 7:42059050-42059072 CTCTTTAAACAAAAGTTAGTGGG - Intronic
1023698529 7:42871587-42871609 ATGACTAGACAGAAGATAGTAGG + Intergenic
1024576760 7:50770694-50770716 CTGCTTTAAGAGAAGGTAGTTGG - Intronic
1027998110 7:85452825-85452847 ATGTATAAACTGAATGTAGTTGG - Intergenic
1028670862 7:93398650-93398672 ATGACTAGACAGAAGATAGTAGG - Intergenic
1030445423 7:109643051-109643073 ATGACTAGACAGAAGATAGTAGG + Intergenic
1030724220 7:112906397-112906419 CTGTATAAACAGAAGGGAAGGGG + Intronic
1030804136 7:113893081-113893103 CTGTGTAAAAGAAAGGTAGTGGG - Intronic
1031354768 7:120777564-120777586 ATGACTAGACAGAAGATAGTAGG + Intergenic
1031422055 7:121564587-121564609 ATGACTAGACAGAAGATAGTAGG + Intergenic
1031526006 7:122821988-122822010 ATGACTAGACAGAAGATAGTAGG - Intronic
1031686204 7:124733763-124733785 ATGACTAGACAGAAGATAGTAGG - Intergenic
1031776672 7:125914728-125914750 ATGACTAGACAGAAGATAGTGGG - Intergenic
1031777810 7:125923139-125923161 ATGACTAGACAGAAGATAGTAGG - Intergenic
1032700167 7:134372343-134372365 ATGACTAAATAGAAGGGAGTGGG + Intergenic
1033464564 7:141579033-141579055 ATGACTAGACAGAAGATAGTAGG + Intronic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034975529 7:155447235-155447257 CTGGCTTAATAGAAGATAGTTGG - Intergenic
1035880266 8:3238942-3238964 ATGACTAGACAGAAGATAGTAGG + Intronic
1036281836 8:7407159-7407181 ATGACTAGACAGAAGATAGTAGG - Intergenic
1036339635 8:7904412-7904434 ATGACTAGACAGAAGATAGTAGG + Intergenic
1036373783 8:8182909-8182931 ATGGCTAGACAGAAGATAGTAGG - Intergenic
1036471893 8:9059851-9059873 ATGACTAGACAGAAGATAGTAGG + Intronic
1036877120 8:12482732-12482754 ATGGCTAGACAGAAGATAGTAGG + Intergenic
1038059182 8:23893110-23893132 CTATCTAGAGAGAAGGCAGTCGG - Intergenic
1040581658 8:48703629-48703651 CTGTCTACCCATATGGTAGTGGG - Intergenic
1041598494 8:59686635-59686657 CTAGCTAAACAGAAGGGAATAGG + Intergenic
1043597061 8:81899300-81899322 ATGACTAGACAGAAGATAGTAGG + Intergenic
1043717479 8:83505636-83505658 ATGACTAGACAGAAGATAGTAGG + Intergenic
1043838142 8:85068207-85068229 ATGACTAGACAGAAGATAGTAGG - Intergenic
1044922343 8:97179764-97179786 ATGACTAGACAGAAGATAGTAGG - Intergenic
1044925523 8:97205655-97205677 ATGACTAGACAGAAGATAGTAGG - Intergenic
1047330571 8:123883312-123883334 CTGCCTCAAGAGAAGGAAGTGGG + Intronic
1047699711 8:127436452-127436474 ATGACTAGACAGAAGATAGTAGG - Intergenic
1047829185 8:128612892-128612914 ATGACTAGACAGAAGATAGTAGG + Intergenic
1048097954 8:131314936-131314958 ATGACTAGACAGAAGATAGTAGG - Intergenic
1048144165 8:131824134-131824156 ATGACTAGACAGAAGATAGTAGG - Intergenic
1048168084 8:132081226-132081248 ATGACTAGACAGAAGATAGTAGG + Intronic
1048585079 8:135768157-135768179 ATGACTAGACAGAAGATAGTAGG + Intergenic
1048763837 8:137825584-137825606 ATGACTAGACAGAAGATAGTAGG + Intergenic
1050257671 9:3811838-3811860 ATGACTAGACAGAAGATAGTAGG + Intergenic
1051713434 9:19956911-19956933 CTGTCTATACACCAGGAAGTAGG + Intergenic
1052192257 9:25674209-25674231 ATGACTAGACAGAAGATAGTAGG - Intergenic
1052720253 9:32165316-32165338 ATGACTAGACAGAAGATAGTAGG + Intergenic
1052897297 9:33759681-33759703 CTGTCTATTCAGCAGGTTGTTGG + Intronic
1053058417 9:35008426-35008448 ATGACTAGACAGAAGATAGTAGG - Intergenic
1055233428 9:74090398-74090420 ATGACTAGACAGAAGATAGTAGG - Intergenic
1055627147 9:78185852-78185874 ATGACTAGACAGAAGATAGTAGG - Intergenic
1055740838 9:79387272-79387294 CTGCTTAAACAGCAGGTTGTGGG - Intergenic
1055882162 9:81014309-81014331 ATGACTAGACAGAAGATAGTAGG - Intergenic
1056061513 9:82888480-82888502 ATGACTAGACAGAAGGTAGTAGG - Intergenic
1056237527 9:84610147-84610169 GTATCTAAACAGAAGGAAGCTGG - Intergenic
1056522805 9:87415662-87415684 ATGACTAGACAGAAGATAGTAGG - Intergenic
1056755473 9:89379292-89379314 TTGTTCAGACAGAAGGTAGTAGG - Exonic
1056883330 9:90417314-90417336 ATGACTAGACAGAAGGTAATAGG - Intergenic
1059545813 9:115175600-115175622 ATGACTAGACAGAAGATAGTAGG + Intronic
1059606345 9:115840169-115840191 ATGACTAGACAGAAGATAGTAGG + Intergenic
1060318060 9:122531427-122531449 ATGACTAGACAGAAGATAGTAGG + Intergenic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1203793313 EBV:163029-163051 CTGGCAAAACTGCAGGTAGTAGG + Intergenic
1185858060 X:3554111-3554133 ATGACTAGACAGAAGATAGTAGG + Intergenic
1185960332 X:4541466-4541488 ATGACTAGACAGAAGATAGTAGG + Intergenic
1185991430 X:4896325-4896347 ATGACTAGACAGAAGATAGTAGG - Intergenic
1186112490 X:6273160-6273182 ATGACTAGACAGAAGATAGTAGG + Intergenic
1186301718 X:8206170-8206192 CTGACTAATCATAATGTAGTTGG + Intergenic
1186784442 X:12944566-12944588 ATGACTAGACAGAAGATAGTAGG - Intergenic
1187086159 X:16045666-16045688 ATGACTAGACAGAAGATAGTAGG + Intergenic
1187099614 X:16180157-16180179 ATGACTAGACAGAAGATAGTAGG + Intergenic
1188200388 X:27288734-27288756 ATGACTAGACAGAAGATAGTAGG + Intergenic
1188862438 X:35272963-35272985 CTGTCTAGAAAGAAGGGAGCAGG + Intergenic
1190447533 X:50543622-50543644 CTCCCAAAACAGAAAGTAGTAGG + Intergenic
1192706596 X:73532988-73533010 ATGGCTAGACAGAAGATAGTAGG - Intergenic
1192731013 X:73802733-73802755 ATGACTAGACAGAAGATAGTAGG + Intergenic
1192763957 X:74124059-74124081 ATGACTAGACAGAAGATAGTAGG + Intergenic
1193587728 X:83346569-83346591 CTGTATAAAATGAAGGTAGTAGG - Intergenic
1193886284 X:86986524-86986546 ATGACTAGACAGAAGATAGTAGG - Intergenic
1193941861 X:87686631-87686653 ATGACTAGACAGAAGATAGTAGG - Intergenic
1194308187 X:92274047-92274069 ATGACTAGACAGAAGATAGTAGG + Intronic
1194367467 X:93027665-93027687 ATGACTAGACAGAAGATAGTAGG - Intergenic
1194502618 X:94699796-94699818 ATGACTAGACAGAAGATAGTAGG + Intergenic
1194661159 X:96629533-96629555 ATGACTAGACAGAAGATAGTAGG - Intergenic
1194822412 X:98525238-98525260 ATGACTAGACAGAAGATAGTAGG + Intergenic
1195016618 X:100787692-100787714 ATGACTAGACAGAAGATAGTAGG + Intergenic
1195290722 X:103429990-103430012 ATGACTAGACAGAAGATAGTAGG + Intergenic
1195326406 X:103762089-103762111 ATGACTAGACAGAAGATAGTAGG + Intergenic
1195841857 X:109183154-109183176 ATGACTAGACAGAAGATAGTAGG - Intergenic
1196073443 X:111548659-111548681 ATGACTAGACAGAAGATAGTAGG - Intergenic
1196165903 X:112535341-112535363 ATGACTAGACAGAAGATAGTAGG - Intergenic
1196220610 X:113109693-113109715 ATGACTAGACAGAAGATAGTAGG + Intergenic
1196331188 X:114471498-114471520 ATGACTAGACAGAAGATAGTAGG - Intergenic
1196341355 X:114602265-114602287 ATGACTAGACAGAAGATAGTAGG + Intronic
1196533193 X:116813463-116813485 ATGACTAGACAGAAGATAGTAGG + Intergenic
1196773507 X:119318755-119318777 ATGACTAGACAGAAGATAGTAGG + Intergenic
1197351689 X:125389831-125389853 ATGACTAGACAGAAGATAGTAGG + Intergenic
1197500190 X:127232071-127232093 ATGACTAGACAGAAGATAGTAGG - Intergenic
1197933453 X:131716803-131716825 ATGACTAGACAGAAGATAGTAGG - Intergenic
1198598804 X:138263540-138263562 ATGACTAGACAGAAGATAGTAGG - Intergenic
1198599043 X:138265295-138265317 ATGACTAGACAGAAGATAGTAGG + Intergenic
1198966401 X:142232060-142232082 ATGACTAGACAGAAGATAGTAGG - Intergenic
1198983353 X:142424330-142424352 ATGACTAGACAGAAGATAGTAGG + Intergenic
1200675676 Y:6143924-6143946 ATGACTAGACAGAAGATAGTAGG - Intergenic
1200764444 Y:7068549-7068571 CAGTCTAGACAGAAGGTTGCAGG - Intronic
1201233755 Y:11890894-11890916 ATGACTAGACAGAAGATAGTAGG + Intergenic