ID: 1177902550

View in Genome Browser
Species Human (GRCh38)
Location 21:26934581-26934603
Sequence TGGTGTGCTGTGGTACGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902550_1177902557 12 Left 1177902550 21:26934581-26934603 CCCTGGCGTACCACAGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1177902557 21:26934616-26934638 GACATCCATGCCGGGACACACGG 0: 1
1: 0
2: 1
3: 6
4: 110
1177902550_1177902555 3 Left 1177902550 21:26934581-26934603 CCCTGGCGTACCACAGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1177902555 21:26934607-26934629 GCGAGCACAGACATCCATGCCGG 0: 1
1: 0
2: 0
3: 6
4: 123
1177902550_1177902556 4 Left 1177902550 21:26934581-26934603 CCCTGGCGTACCACAGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324
1177902550_1177902560 22 Left 1177902550 21:26934581-26934603 CCCTGGCGTACCACAGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902550 Original CRISPR TGGTGTGCTGTGGTACGCCA GGG (reversed) Exonic