ID: 1177902551

View in Genome Browser
Species Human (GRCh38)
Location 21:26934582-26934604
Sequence GTGGTGTGCTGTGGTACGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902551_1177902557 11 Left 1177902551 21:26934582-26934604 CCTGGCGTACCACAGCACACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1177902557 21:26934616-26934638 GACATCCATGCCGGGACACACGG 0: 1
1: 0
2: 1
3: 6
4: 110
1177902551_1177902556 3 Left 1177902551 21:26934582-26934604 CCTGGCGTACCACAGCACACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324
1177902551_1177902560 21 Left 1177902551 21:26934582-26934604 CCTGGCGTACCACAGCACACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1177902551_1177902555 2 Left 1177902551 21:26934582-26934604 CCTGGCGTACCACAGCACACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1177902555 21:26934607-26934629 GCGAGCACAGACATCCATGCCGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902551 Original CRISPR GTGGTGTGCTGTGGTACGCC AGG (reversed) Exonic