ID: 1177902553

View in Genome Browser
Species Human (GRCh38)
Location 21:26934591-26934613
Sequence TGCTCGCCTGTGGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902553_1177902556 -6 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324
1177902553_1177902561 25 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902561 21:26934639-26934661 AGTACTCAGGCCCGAATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1177902553_1177902555 -7 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902555 21:26934607-26934629 GCGAGCACAGACATCCATGCCGG 0: 1
1: 0
2: 0
3: 6
4: 123
1177902553_1177902557 2 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902557 21:26934616-26934638 GACATCCATGCCGGGACACACGG 0: 1
1: 0
2: 1
3: 6
4: 110
1177902553_1177902560 12 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902553 Original CRISPR TGCTCGCCTGTGGTGTGCTG TGG (reversed) Exonic