ID: 1177902554

View in Genome Browser
Species Human (GRCh38)
Location 21:26934601-26934623
Sequence TGGATGTCTGTGCTCGCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902554_1177902561 15 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902561 21:26934639-26934661 AGTACTCAGGCCCGAATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1177902554_1177902564 27 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902564 21:26934651-26934673 CGAATGTCAGGTTGCACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 57
1177902554_1177902560 2 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1177902554_1177902557 -8 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902557 21:26934616-26934638 GACATCCATGCCGGGACACACGG 0: 1
1: 0
2: 1
3: 6
4: 110
1177902554_1177902565 28 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902565 21:26934652-26934674 GAATGTCAGGTTGCACTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902554 Original CRISPR TGGATGTCTGTGCTCGCCTG TGG (reversed) Exonic