ID: 1177902556

View in Genome Browser
Species Human (GRCh38)
Location 21:26934608-26934630
Sequence CGAGCACAGACATCCATGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902551_1177902556 3 Left 1177902551 21:26934582-26934604 CCTGGCGTACCACAGCACACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324
1177902553_1177902556 -6 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324
1177902549_1177902556 12 Left 1177902549 21:26934573-26934595 CCATCTGGCCCTGGCGTACCACA 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324
1177902550_1177902556 4 Left 1177902550 21:26934581-26934603 CCCTGGCGTACCACAGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1177902556 21:26934608-26934630 CGAGCACAGACATCCATGCCGGG 0: 1
1: 0
2: 2
3: 28
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902556 Original CRISPR CGAGCACAGACATCCATGCC GGG Exonic