ID: 1177902558

View in Genome Browser
Species Human (GRCh38)
Location 21:26934621-26934643
Sequence GTACTCCGTGTGTCCCGGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902558_1177902561 -5 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902561 21:26934639-26934661 AGTACTCAGGCCCGAATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1177902558_1177902568 30 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902568 21:26934674-26934696 GTGGCATCGTAGGTCTGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1177902558_1177902565 8 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902565 21:26934652-26934674 GAATGTCAGGTTGCACTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1177902558_1177902564 7 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902564 21:26934651-26934673 CGAATGTCAGGTTGCACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 57
1177902558_1177902566 11 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902566 21:26934655-26934677 TGTCAGGTTGCACTGCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 152
1177902558_1177902567 20 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902567 21:26934664-26934686 GCACTGCTGGGTGGCATCGTAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902558 Original CRISPR GTACTCCGTGTGTCCCGGCA TGG (reversed) Exonic