ID: 1177902559

View in Genome Browser
Species Human (GRCh38)
Location 21:26934626-26934648
Sequence CCTGAGTACTCCGTGTGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902559_1177902565 3 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902565 21:26934652-26934674 GAATGTCAGGTTGCACTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1177902559_1177902564 2 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902564 21:26934651-26934673 CGAATGTCAGGTTGCACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 57
1177902559_1177902568 25 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902568 21:26934674-26934696 GTGGCATCGTAGGTCTGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1177902559_1177902561 -10 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902561 21:26934639-26934661 AGTACTCAGGCCCGAATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1177902559_1177902567 15 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902567 21:26934664-26934686 GCACTGCTGGGTGGCATCGTAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1177902559_1177902566 6 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902566 21:26934655-26934677 TGTCAGGTTGCACTGCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 152
1177902559_1177902569 26 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902569 21:26934675-26934697 TGGCATCGTAGGTCTGTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902559 Original CRISPR CCTGAGTACTCCGTGTGTCC CGG (reversed) Exonic