ID: 1177902560

View in Genome Browser
Species Human (GRCh38)
Location 21:26934626-26934648
Sequence CCGGGACACACGGAGTACTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902549_1177902560 30 Left 1177902549 21:26934573-26934595 CCATCTGGCCCTGGCGTACCACA 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1177902550_1177902560 22 Left 1177902550 21:26934581-26934603 CCCTGGCGTACCACAGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1177902553_1177902560 12 Left 1177902553 21:26934591-26934613 CCACAGCACACCACAGGCGAGCA 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1177902554_1177902560 2 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
1177902551_1177902560 21 Left 1177902551 21:26934582-26934604 CCTGGCGTACCACAGCACACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1177902560 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902560 Original CRISPR CCGGGACACACGGAGTACTC AGG Exonic