ID: 1177902565

View in Genome Browser
Species Human (GRCh38)
Location 21:26934652-26934674
Sequence GAATGTCAGGTTGCACTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902554_1177902565 28 Left 1177902554 21:26934601-26934623 CCACAGGCGAGCACAGACATCCA 0: 1
1: 0
2: 2
3: 10
4: 146
Right 1177902565 21:26934652-26934674 GAATGTCAGGTTGCACTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1177902558_1177902565 8 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902565 21:26934652-26934674 GAATGTCAGGTTGCACTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1177902559_1177902565 3 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902565 21:26934652-26934674 GAATGTCAGGTTGCACTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902565 Original CRISPR GAATGTCAGGTTGCACTGCT GGG Exonic