ID: 1177902566

View in Genome Browser
Species Human (GRCh38)
Location 21:26934655-26934677
Sequence TGTCAGGTTGCACTGCTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902558_1177902566 11 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902566 21:26934655-26934677 TGTCAGGTTGCACTGCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 152
1177902559_1177902566 6 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902566 21:26934655-26934677 TGTCAGGTTGCACTGCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902566 Original CRISPR TGTCAGGTTGCACTGCTGGG TGG Exonic