ID: 1177902567

View in Genome Browser
Species Human (GRCh38)
Location 21:26934664-26934686
Sequence GCACTGCTGGGTGGCATCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902558_1177902567 20 Left 1177902558 21:26934621-26934643 CCATGCCGGGACACACGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1177902567 21:26934664-26934686 GCACTGCTGGGTGGCATCGTAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1177902559_1177902567 15 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902567 21:26934664-26934686 GCACTGCTGGGTGGCATCGTAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1177902562_1177902567 -8 Left 1177902562 21:26934649-26934671 CCCGAATGTCAGGTTGCACTGCT 0: 1
1: 0
2: 1
3: 67
4: 264
Right 1177902567 21:26934664-26934686 GCACTGCTGGGTGGCATCGTAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1177902563_1177902567 -9 Left 1177902563 21:26934650-26934672 CCGAATGTCAGGTTGCACTGCTG 0: 1
1: 1
2: 0
3: 13
4: 198
Right 1177902567 21:26934664-26934686 GCACTGCTGGGTGGCATCGTAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902567 Original CRISPR GCACTGCTGGGTGGCATCGT AGG Exonic