ID: 1177902569

View in Genome Browser
Species Human (GRCh38)
Location 21:26934675-26934697
Sequence TGGCATCGTAGGTCTGTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177902563_1177902569 2 Left 1177902563 21:26934650-26934672 CCGAATGTCAGGTTGCACTGCTG 0: 1
1: 1
2: 0
3: 13
4: 198
Right 1177902569 21:26934675-26934697 TGGCATCGTAGGTCTGTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1177902559_1177902569 26 Left 1177902559 21:26934626-26934648 CCGGGACACACGGAGTACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1177902569 21:26934675-26934697 TGGCATCGTAGGTCTGTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1177902562_1177902569 3 Left 1177902562 21:26934649-26934671 CCCGAATGTCAGGTTGCACTGCT 0: 1
1: 0
2: 1
3: 67
4: 264
Right 1177902569 21:26934675-26934697 TGGCATCGTAGGTCTGTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177902569 Original CRISPR TGGCATCGTAGGTCTGTCCT GGG Exonic