ID: 1177905662

View in Genome Browser
Species Human (GRCh38)
Location 21:26968313-26968335
Sequence CCTTCTAACCATAAGTCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177905662_1177905666 -4 Left 1177905662 21:26968313-26968335 CCCGACGACTTATGGTTAGAAGG No data
Right 1177905666 21:26968332-26968354 AAGGTCTACCTTCTACTGTAGGG No data
1177905662_1177905665 -5 Left 1177905662 21:26968313-26968335 CCCGACGACTTATGGTTAGAAGG No data
Right 1177905665 21:26968331-26968353 GAAGGTCTACCTTCTACTGTAGG No data
1177905662_1177905667 -3 Left 1177905662 21:26968313-26968335 CCCGACGACTTATGGTTAGAAGG No data
Right 1177905667 21:26968333-26968355 AGGTCTACCTTCTACTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177905662 Original CRISPR CCTTCTAACCATAAGTCGTC GGG (reversed) Intergenic
No off target data available for this crispr