ID: 1177906026

View in Genome Browser
Species Human (GRCh38)
Location 21:26972304-26972326
Sequence CTGGAAGAGGGTTCCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177906026_1177906038 28 Left 1177906026 21:26972304-26972326 CCCAGGAAGGAACCCTCTTCCAG No data
Right 1177906038 21:26972355-26972377 TCCTTCCAGCTGGCCCAACCTGG No data
1177906026_1177906034 18 Left 1177906026 21:26972304-26972326 CCCAGGAAGGAACCCTCTTCCAG No data
Right 1177906034 21:26972345-26972367 CCCCCTTTTCTCCTTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177906026 Original CRISPR CTGGAAGAGGGTTCCTTCCT GGG (reversed) Intergenic
No off target data available for this crispr