ID: 1177907463

View in Genome Browser
Species Human (GRCh38)
Location 21:26989482-26989504
Sequence TTTCCTGATGGCCCGCCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177907463_1177907467 23 Left 1177907463 21:26989482-26989504 CCATAGGGCGGGCCATCAGGAAA No data
Right 1177907467 21:26989528-26989550 AATCTGAAGCTGCAGTCCACAGG No data
1177907463_1177907468 27 Left 1177907463 21:26989482-26989504 CCATAGGGCGGGCCATCAGGAAA No data
Right 1177907468 21:26989532-26989554 TGAAGCTGCAGTCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177907463 Original CRISPR TTTCCTGATGGCCCGCCCTA TGG (reversed) Intergenic
No off target data available for this crispr