ID: 1177910678

View in Genome Browser
Species Human (GRCh38)
Location 21:27027258-27027280
Sequence AAAGTCTGTTTCAGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177910678_1177910680 17 Left 1177910678 21:27027258-27027280 CCAGTCTTTCTGAAACAGACTTT No data
Right 1177910680 21:27027298-27027320 CAATTACGTGTCTTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177910678 Original CRISPR AAAGTCTGTTTCAGAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr