ID: 1177911255

View in Genome Browser
Species Human (GRCh38)
Location 21:27035431-27035453
Sequence GCTTCAAGTGTCCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177911255_1177911257 -6 Left 1177911255 21:27035431-27035453 CCAGCCTGTGGGACACTTGAAGC No data
Right 1177911257 21:27035448-27035470 TGAAGCCATTTAAAATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177911255 Original CRISPR GCTTCAAGTGTCCCACAGGC TGG (reversed) Intergenic
No off target data available for this crispr