ID: 1177923705

View in Genome Browser
Species Human (GRCh38)
Location 21:27186977-27186999
Sequence GATTTACCGGGAGCATGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177923697_1177923705 6 Left 1177923697 21:27186948-27186970 CCCACTTTAAAGATACTACCCAG No data
Right 1177923705 21:27186977-27186999 GATTTACCGGGAGCATGATCTGG No data
1177923698_1177923705 5 Left 1177923698 21:27186949-27186971 CCACTTTAAAGATACTACCCAGG No data
Right 1177923705 21:27186977-27186999 GATTTACCGGGAGCATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177923705 Original CRISPR GATTTACCGGGAGCATGATC TGG Intergenic
No off target data available for this crispr