ID: 1177926630

View in Genome Browser
Species Human (GRCh38)
Location 21:27224139-27224161
Sequence AAATAAGCACAGATGTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177926629_1177926630 -8 Left 1177926629 21:27224124-27224146 CCATGCATTGTTTTTAAATAAGC No data
Right 1177926630 21:27224139-27224161 AAATAAGCACAGATGTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177926630 Original CRISPR AAATAAGCACAGATGTAACA AGG Intergenic
No off target data available for this crispr