ID: 1177929469

View in Genome Browser
Species Human (GRCh38)
Location 21:27263010-27263032
Sequence GACTCTTTTCCCTTTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177929465_1177929469 22 Left 1177929465 21:27262965-27262987 CCACTGGAATGGGATTTAGTTTG No data
Right 1177929469 21:27263010-27263032 GACTCTTTTCCCTTTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177929469 Original CRISPR GACTCTTTTCCCTTTTAGGG AGG Intergenic
No off target data available for this crispr