ID: 1177933440

View in Genome Browser
Species Human (GRCh38)
Location 21:27314995-27315017
Sequence CAGGACATGGAAAAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177933440_1177933444 5 Left 1177933440 21:27314995-27315017 CCTGTCTCCTTTTCCATGTCCTG No data
Right 1177933444 21:27315023-27315045 TTTCTCTGATTTCTTTATGTTGG No data
1177933440_1177933445 22 Left 1177933440 21:27314995-27315017 CCTGTCTCCTTTTCCATGTCCTG No data
Right 1177933445 21:27315040-27315062 TGTTGGTTTTAGTTTTCTCTTGG 0: 2
1: 1
2: 8
3: 62
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177933440 Original CRISPR CAGGACATGGAAAAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr