ID: 1177935362

View in Genome Browser
Species Human (GRCh38)
Location 21:27338529-27338551
Sequence CTGATGTCCTTCAGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177935359_1177935362 27 Left 1177935359 21:27338479-27338501 CCAAACATGGACAAAGGACTCTC No data
Right 1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177935362 Original CRISPR CTGATGTCCTTCAGAAAAAA AGG Intergenic
No off target data available for this crispr