ID: 1177937609

View in Genome Browser
Species Human (GRCh38)
Location 21:27368606-27368628
Sequence CAAGTTTCCCAGCTTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177937609_1177937613 1 Left 1177937609 21:27368606-27368628 CCTATTTAAAGCTGGGAAACTTG No data
Right 1177937613 21:27368630-27368652 ATGCTACTTAGGAAATGGGTTGG No data
1177937609_1177937610 -10 Left 1177937609 21:27368606-27368628 CCTATTTAAAGCTGGGAAACTTG No data
Right 1177937610 21:27368619-27368641 GGGAAACTTGCATGCTACTTAGG No data
1177937609_1177937611 -4 Left 1177937609 21:27368606-27368628 CCTATTTAAAGCTGGGAAACTTG No data
Right 1177937611 21:27368625-27368647 CTTGCATGCTACTTAGGAAATGG No data
1177937609_1177937612 -3 Left 1177937609 21:27368606-27368628 CCTATTTAAAGCTGGGAAACTTG No data
Right 1177937612 21:27368626-27368648 TTGCATGCTACTTAGGAAATGGG No data
1177937609_1177937614 21 Left 1177937609 21:27368606-27368628 CCTATTTAAAGCTGGGAAACTTG No data
Right 1177937614 21:27368650-27368672 TGGAATTATTTTCTTAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177937609 Original CRISPR CAAGTTTCCCAGCTTTAAAT AGG (reversed) Intergenic
No off target data available for this crispr