ID: 1177943734

View in Genome Browser
Species Human (GRCh38)
Location 21:27442500-27442522
Sequence GCATGGACAAAGGTTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177943726_1177943734 17 Left 1177943726 21:27442460-27442482 CCCAAGATAGCTTAAAAGCAAGT No data
Right 1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG No data
1177943727_1177943734 16 Left 1177943727 21:27442461-27442483 CCAAGATAGCTTAAAAGCAAGTC No data
Right 1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177943734 Original CRISPR GCATGGACAAAGGTTGGGGT GGG Intergenic
No off target data available for this crispr