ID: 1177944680

View in Genome Browser
Species Human (GRCh38)
Location 21:27453069-27453091
Sequence GTGAACCCAACCAAGGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177944677_1177944680 30 Left 1177944677 21:27453016-27453038 CCAGTGTGGATCATACTACTCTT No data
Right 1177944680 21:27453069-27453091 GTGAACCCAACCAAGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177944680 Original CRISPR GTGAACCCAACCAAGGTGAC TGG Intergenic
No off target data available for this crispr