ID: 1177948990

View in Genome Browser
Species Human (GRCh38)
Location 21:27510367-27510389
Sequence TCCGTGTAGCCGCGAACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177948990_1177948991 8 Left 1177948990 21:27510367-27510389 CCAAGAGTTCGCGGCTACACGGA No data
Right 1177948991 21:27510398-27510420 TGTGCCCCTGCGCTCCAGCCTGG No data
1177948990_1177948992 9 Left 1177948990 21:27510367-27510389 CCAAGAGTTCGCGGCTACACGGA No data
Right 1177948992 21:27510399-27510421 GTGCCCCTGCGCTCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177948990 Original CRISPR TCCGTGTAGCCGCGAACTCT TGG (reversed) Intergenic